ADH5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81124-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ADH5 Reagents
CRO Services
Product recommended

All ADH5 Reagents
ADH5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Description
Full length Clone DNA of Rat alcohol dehydrogenase 5 (class III), chi polypeptide with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADH5 Background Information

Carbonic anhydrases IX (CAIX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide ( H2O + CO2 = H+ + HCO3- ) and thus participate in a variety of biological and physical processes. CAIX is a transmembrane protein structurally consisting of a signal peptide, a proteoglycan-related region, a CA domain with a highly conserved active site, a transmembrane anchor and an intracytoplasmic tail, and is the only tumor-associated CA isoenzyme known so far. Compared with normal tissues, CAIX is overexpressed in a wide spectrum of tumor types and associated with increased metastasis and poor prognosis in aggressive carcinomas. CAIX expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. CA9 is regarded as a new therapeutic target for CA9-derived carcinomas.

Full Name
alcohol dehydrogenase 5 (class III), chi polypeptide
References
  • Pastorek, J. et al., 1994, Oncogene. 9: 2877-88.
  • Opavsky, R. et al., 1996, Genomics. 33: 480-7.
  • Swietach, P. et al., 2008, J. Biol. Chem. 283: 20473-83.
  • Robertson, N. et al., 2004, Cancer. Res. 64: 6160-5.
  • Bui, M.H. et al., 2003, Clin. Cancer. Res. 9: 802-11.
  • Choi, S.W. et al., 2008, Hum. Pathol. 39: 1317-22.
  • ADH5 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ADH5 cDNA ORF Clone in Cloning Vector, Rat RG81124-U
    ADH5 cDNA ORF Clone, Rat, untagged RG81124-UT
    ADH5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81124-ACG
    ADH5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81124-ACGLN
    ADH5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81124-ANG
    ADH5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81124-ACR
    ADH5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81124-ANR
    ADH5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81124-NF
    ADH5 cDNA ORF Clone, Rat, C-His tag RG81124-CH
    ADH5 cDNA ORF Clone, Rat, N-His tag RG81124-NH
    ADH5 cDNA ORF Clone, Rat, C-HA tag RG81124-CY
    ADH5 cDNA ORF Clone, Rat, N-HA tag RG81124-NY
    ADH5 cDNA ORF Clone, Rat, C-Myc tag RG81124-CM
    ADH5 cDNA ORF Clone, Rat, N-Myc tag RG81124-NM
    ADH5 qPCR Primer Pairs, Rat RP301081

    ADH5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ADH5 cDNA ORF Clone in Cloning Vector, Mouse MG53541-G
    ADH5 cDNA ORF Clone, Mouse, untagged MG53541-UT
    ADH5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53541-ACG
    ADH5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53541-ACGLN
    ADH5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53541-ANG
    ADH5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53541-ACR
    ADH5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53541-ANR
    ADH5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53541-CF
    ADH5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53541-NF
    ADH5 cDNA ORF Clone, Mouse, C-His tag MG53541-CH
    ADH5 cDNA ORF Clone, Mouse, N-His tag MG53541-NH
    ADH5 cDNA ORF Clone, Mouse, C-HA tag MG53541-CY
    ADH5 cDNA ORF Clone, Mouse, N-HA tag MG53541-NY
    ADH5 cDNA ORF Clone, Mouse, C-Myc tag MG53541-CM
    ADH5 cDNA ORF Clone, Mouse, N-Myc tag MG53541-NM

    ADH5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ADH5 cDNA ORF Clone in Cloning Vector, Human HG17057-U
    ADH5 cDNA ORF Clone, Human, untagged HG12412-UT
    ADH5 cDNA ORF Clone, Human, untagged HG17057-UT
    ADH5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17057-ACGLN
    ADH5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12412-ACGLN
    ADH5 cDNA ORF Clone, Human, C-GFPSpark® tag HG17057-ACG
    ADH5 cDNA ORF Clone, Human, N-GFPSpark® tag HG17057-ANG
    ADH5 cDNA ORF Clone, Human, C-OFPSpark® tag HG17057-ACR
    ADH5 cDNA ORF Clone, Human, N-OFPSpark® tag HG17057-ANR
    ADH5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17057-CF
    ADH5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17057-NF
    ADH5 cDNA ORF Clone, Human, C-His tag HG17057-CH
    ADH5 cDNA ORF Clone, Human, N-His tag HG17057-NH
    ADH5 cDNA ORF Clone, Human, C-HA tag HG17057-CY
    ADH5 cDNA ORF Clone, Human, N-HA tag HG17057-NY
    ADH5 cDNA ORF Clone, Human, C-Myc tag HG17057-CM
    ADH5 cDNA ORF Clone, Human, N-Myc tag HG17057-NM
    ADH5 qPCR Primer Pairs, Human HP104766
    info info
    添加购物车成功! 添加购物车失败!