ACAA2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81149-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACAA2 Reagents
CRO Services
Product recommended

All ACAA2 Reagents
ACAA2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1194 bp
Description
Full length Clone DNA of Rat acetyl-CoA acyltransferase 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACAA2 Background Information
Full Name
acetyl-CoA acyltransferase 2

ACAA2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ACAA2 cDNA ORF Clone in Cloning Vector, Rat RG81149-U
ACAA2 cDNA ORF Clone, Rat, untagged RG81149-UT
ACAA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81149-ACGLN
ACAA2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81149-ACG
ACAA2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81149-ANG
ACAA2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81149-ACR
ACAA2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81149-ANR
ACAA2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81149-NF
ACAA2 cDNA ORF Clone, Rat, C-His tag RG81149-CH
ACAA2 cDNA ORF Clone, Rat, N-His tag RG81149-NH
ACAA2 cDNA ORF Clone, Rat, C-HA tag RG81149-CY
ACAA2 cDNA ORF Clone, Rat, N-HA tag RG81149-NY
ACAA2 cDNA ORF Clone, Rat, C-Myc tag RG81149-CM
ACAA2 cDNA ORF Clone, Rat, N-Myc tag RG81149-NM
ACAA2 qPCR Primer Pairs, Rat RP301105

ACAA2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACAA2 cDNA ORF Clone in Cloning Vector, Mouse MG51932-U
ACAA2 cDNA ORF Clone, Mouse, untagged MG51932-UT
ACAA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51932-ACG
ACAA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51932-ACGLN
ACAA2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51932-ANG
ACAA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51932-ACR
ACAA2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51932-ANR
ACAA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51932-CF
ACAA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51932-NF
ACAA2 cDNA ORF Clone, Mouse, C-His tag MG51932-CH
ACAA2 cDNA ORF Clone, Mouse, N-His tag MG51932-NH
ACAA2 cDNA ORF Clone, Mouse, C-HA tag MG51932-CY
ACAA2 cDNA ORF Clone, Mouse, N-HA tag MG51932-NY
ACAA2 cDNA ORF Clone, Mouse, C-Myc tag MG51932-CM
ACAA2 cDNA ORF Clone, Mouse, N-Myc tag MG51932-NM
ACAA2 qPCR Primer Pairs, Mouse MP201805

ACAA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACAA2 cDNA ORF Clone in Cloning Vector, Human HG14894-G
ACAA2 cDNA ORF Clone, Human, untagged HG14894-UT
ACAA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14894-ACG
ACAA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14894-ACGLN
ACAA2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14894-ANG
ACAA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14894-ACR
ACAA2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14894-ANR
ACAA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14894-CF
ACAA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14894-NF
ACAA2 cDNA ORF Clone, Human, C-His tag HG14894-CH
ACAA2 cDNA ORF Clone, Human, N-His tag HG14894-NH
ACAA2 cDNA ORF Clone, Human, C-HA tag HG14894-CY
ACAA2 cDNA ORF Clone, Human, N-HA tag HG14894-NY
ACAA2 cDNA ORF Clone, Human, C-Myc tag HG14894-CM
ACAA2 cDNA ORF Clone, Human, N-Myc tag HG14894-NM
ACAA2 qPCR Primer Pairs, Human HP103523
info info
添加购物车成功! 添加购物车失败!