CD38 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag

Cat: TG65003-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD38 Reagents
CRO Services
Product recommended

All CD38 Reagents
CD38 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Rabbit CD38 molecule with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD38 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 38 (CD38), also known as ADP-ribosyl cyclase, is a glycoprotein found on the surface of many immune cells (white blood cells), including CD4+, CD8+, B and natural killer cells. It shares several characteristics with ADP-ribosyl cyclase 2 CD157. CD38 is a multifunctional ectoenzyme that catalyzes the synthesis and hydrolysis of cyclic ADP-ribose (cADPR) from NAD+ to ADP-ribose. It also functions in cell adhesion, signal transduction and calcium signaling. CD38 has been used as a prognostic marker in leukemia. It can also be used to identify plasma cells.

Full Name
CD38 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • CD38 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    CD38 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90050-G
    CD38 cDNA ORF Clone, Cynomolgus, untagged CG90050-UT
    CD38 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90050-ACG
    CD38 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90050-ACGLN
    CD38 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90050-ACR
    CD38 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90050-CF
    CD38 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90050-NF
    CD38 cDNA ORF Clone, Cynomolgus, C-His tag CG90050-CH
    CD38 cDNA ORF Clone, Cynomolgus, N-His tag CG90050-NH
    CD38 cDNA ORF Clone, Cynomolgus, C-HA tag CG90050-CY
    CD38 cDNA ORF Clone, Cynomolgus, N-HA tag CG90050-NY
    CD38 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90050-CM
    CD38 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90050-NM

    CD38 cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    CD38 cDNA ORF Clone in Cloning Vector, Rabbit TG65003-G
    CD38 cDNA ORF Clone, Rabbit, untagged TG65003-UT
    CD38 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65003-ACG
    CD38 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65003-ACGLN
    CD38 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65003-ACR
    CD38 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65003-CF
    CD38 cDNA ORF Clone, Rabbit, C-His tag TG65003-CH
    CD38 cDNA ORF Clone, Rabbit, N-His tag TG65003-NH
    CD38 cDNA ORF Clone, Rabbit, C-HA tag TG65003-CY
    CD38 cDNA ORF Clone, Rabbit, N-HA tag TG65003-NY
    CD38 cDNA ORF Clone, Rabbit, C-Myc tag TG65003-CM
    CD38 cDNA ORF Clone, Rabbit, N-Myc tag TG65003-NM

    CD38 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD38 cDNA ORF Clone in Cloning Vector, Rat RG80229-G
    CD38 cDNA ORF Clone, Rat, untagged RG80229-UT
    CD38 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80229-ACG
    CD38 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80229-ACGLN
    CD38 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80229-ACR
    CD38 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80229-CF
    CD38 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80229-NF
    CD38 cDNA ORF Clone, Rat, C-His tag RG80229-CH
    CD38 cDNA ORF Clone, Rat, N-His tag RG80229-NH
    CD38 cDNA ORF Clone, Rat, C-HA tag RG80229-CY
    CD38 cDNA ORF Clone, Rat, N-HA tag RG80229-NY
    CD38 cDNA ORF Clone, Rat, C-Myc tag RG80229-CM
    CD38 cDNA ORF Clone, Rat, N-Myc tag RG80229-NM
    CD38 qPCR Primer Pairs, Rat RP300123

    CD38 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD38 cDNA ORF Clone in Cloning Vector, Mouse MG50191-M
    CD38 cDNA ORF Clone, Mouse, untagged MG50191-UT
    CD38 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50191-ACG
    CD38 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50191-ACGLN
    CD38 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50191-ACR
    CD38 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50191-CF
    CD38 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50191-NF
    CD38 cDNA ORF Clone, Mouse, C-His tag MG50191-CH
    CD38 cDNA ORF Clone, Mouse, N-His tag MG50191-NH
    CD38 cDNA ORF Clone, Mouse, C-HA tag MG50191-CY
    CD38 cDNA ORF Clone, Mouse, N-HA tag MG50191-NY
    CD38 cDNA ORF Clone, Mouse, C-Myc tag MG50191-CM
    CD38 cDNA ORF Clone, Mouse, N-Myc tag MG50191-NM
    CD38 qPCR Primer Pairs, Mouse MP200221

    CD38 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD38 cDNA ORF Clone in Cloning Vector, Human HG10818-M
    CD38 cDNA ORF Clone, Human, untagged HG10818-UT
    CD38 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10818-ACGLN
    CD38 cDNA ORF Clone, Human, C-GFPSpark® tag HG10818-ACG
    CD38 cDNA ORF Clone, Human, C-OFPSpark® tag HG10818-ACR
    CD38 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10818-CF
    CD38 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10818-NF
    CD38 cDNA ORF Clone, Human, C-His tag HG10818-CH
    CD38 cDNA ORF Clone, Human, N-His tag HG10818-NH
    CD38 cDNA ORF Clone, Human, C-HA tag HG10818-CY
    CD38 cDNA ORF Clone, Human, N-HA tag HG10818-NY
    CD38 cDNA ORF Clone, Human, C-Myc tag HG10818-CM
    CD38 cDNA ORF Clone, Human, N-Myc tag HG10818-NM
    CD38 qPCR Primer Pairs, Human HP100723
    info info
    添加购物车成功! 添加购物车失败!