PCSK1 cDNA ORF Clone, Human, untagged

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

PCSK1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2262 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human proprotein convertase subtilisin/kexin type 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI (5.5kb + 2.26kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PCSK1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCSK1 cDNA ORF Clone, Human, untagged: Validated Images

PCSK1 cDNA ORF Clone, Human, untagged: Alternative Names

BMIQ12 cDNA ORF Clone, Human; NEC1 cDNA ORF Clone, Human; PC1 cDNA ORF Clone, Human; PC3 cDNA ORF Clone, Human; SPC3 cDNA ORF Clone, Human

PCSK1 Background Information

Neuroendocrine convertase 1, also known as Prohormone convertase 1, Proprotein convertase 1, PCSK1 and NEC1, is anenzyme which belongs to thepeptidase S8 family and Furin subfamily. PCSK1 is an enzyme that performs the proteolytic cleavage of prohormones to their intermediate (or sometimes completely cleaved) forms. It is present only in neuroendocrine cells such as brain, pituitary and adrenal, and most often cleaves after a pair of basic residues within prohormones but can occasionally cleave after a single arginine. It binds to a protein known as proSAAS, which also represents its endogenous inhibitor. PCSK1 is involved in the processing of hormone and other protein precursors at sites comprised of pairs of basic amino acid residues. PCSK1 substrates include POMC, renin, enkephalin, dynorphin, somatostatin and insulin. Defects in PCSK1 are the cause of proprotein convertase 1 deficiency (PC1 deficiency). PC1 deficiency is characterized by obesity, hypogonadism, hypoadrenalism, reactive hypoglycemia as well as marked small-intestinal absorptive dysfunction. It is due to impaired processing of prohormones.
Full Name
proprotein convertase subtilisin/kexin type 1
References
  • Jackson RS. et al., 2003, J. Clin. Invest. 112:1550-60.
  • Farooqi I.S. et al., 2007, J. Clin. Endocrinol. Metab. 92: 3369-73.
  • Benzinou,M. et al., 2008,Nat Genet. 40 (8):943-5.
  • Benzinou M. et al., 2008, Nat. Genet. 40:943-5.
  • Renström F, et al., 2009, Hum. Mol. Genet. 18 (8): 1489-96.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait