YAE1D1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52547-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All YAE1D1 Reagents
CRO Services
Product recommended

All YAE1D1 Reagents
YAE1D1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
651 bp
Description
Full length Clone DNA of Mouse Yae1 domain containing 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

YAE1D1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1600012F09Rik cDNA ORF Clone, Mouse
YAE1D1 Background Information
Full Name
Yae1 domain containing 1

YAE1D1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
YAE1D1 cDNA ORF Clone in Cloning Vector, Mouse MG52547-U
YAE1D1 cDNA ORF Clone, Mouse, untagged MG52547-UT
YAE1D1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52547-ACG
YAE1D1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52547-ACGLN
YAE1D1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52547-ANG
YAE1D1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52547-ACR
YAE1D1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52547-ANR
YAE1D1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52547-CF
YAE1D1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52547-NF
YAE1D1 cDNA ORF Clone, Mouse, C-His tag MG52547-CH
YAE1D1 cDNA ORF Clone, Mouse, C-HA tag MG52547-CY
YAE1D1 cDNA ORF Clone, Mouse, N-HA tag MG52547-NY
YAE1D1 cDNA ORF Clone, Mouse, C-Myc tag MG52547-CM
YAE1D1 cDNA ORF Clone, Mouse, N-Myc tag MG52547-NM
YAE1D1 qPCR Primer Pairs, Mouse MP202420

YAE1D1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
YAE1D1 cDNA ORF Clone in Cloning Vector, Human HG16902-U
YAE1D1 cDNA ORF Clone, Human, untagged HG16902-UT
YAE1D1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16902-ACG
YAE1D1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16902-ACGLN
YAE1D1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16902-ANG
YAE1D1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16902-ACR
YAE1D1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16902-ANR
YAE1D1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16902-CF
YAE1D1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16902-NF
YAE1D1 cDNA ORF Clone, Human, C-His tag HG16902-CH
YAE1D1 cDNA ORF Clone, Human, N-His tag HG16902-NH
YAE1D1 cDNA ORF Clone, Human, C-HA tag HG16902-CY
YAE1D1 cDNA ORF Clone, Human, N-HA tag HG16902-NY
YAE1D1 cDNA ORF Clone, Human, C-Myc tag HG16902-CM
YAE1D1 cDNA ORF Clone, Human, N-Myc tag HG16902-NM
info info
添加购物车成功! 添加购物车失败!