UBE2V1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51466-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All UBE2V1 Reagents
CRO Services
Product recommended

All UBE2V1 Reagents
UBE2V1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Mouse ubiquitin-conjugating enzyme E2 variant 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBE2V1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
0610011J09Rik cDNA ORF Clone, Mouse;AI256840 cDNA ORF Clone, Mouse;CROC-1 cDNA ORF Clone, Mouse;CROC1 cDNA ORF Clone, Mouse;D7Bwg1382e cDNA ORF Clone, Mouse;UEV-1 cDNA ORF Clone, Mouse
UBE2V1 Background Information
Full Name
ubiquitin-conjugating enzyme E2 variant 1

UBE2V1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UBE2V1 cDNA ORF Clone in Cloning Vector, Rat RG81254-U
UBE2V1 cDNA ORF Clone, Rat, untagged RG81254-UT
UBE2V1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81254-ACG
UBE2V1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81254-ACGLN
UBE2V1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81254-ANG
UBE2V1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81254-ACR
UBE2V1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81254-ANR
UBE2V1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81254-CF
UBE2V1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81254-NF
UBE2V1 cDNA ORF Clone, Rat, C-His tag RG81254-CH
UBE2V1 cDNA ORF Clone, Rat, N-His tag RG81254-NH
UBE2V1 cDNA ORF Clone, Rat, C-HA tag RG81254-CY
UBE2V1 cDNA ORF Clone, Rat, N-HA tag RG81254-NY
UBE2V1 cDNA ORF Clone, Rat, C-Myc tag RG81254-CM
UBE2V1 cDNA ORF Clone, Rat, N-Myc tag RG81254-NM
UBE2V1 qPCR Primer Pairs, Rat RP301210

UBE2V1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBE2V1 cDNA ORF Clone in Cloning Vector, Mouse MG51466-G
UBE2V1 cDNA ORF Clone, Mouse, untagged MG51466-UT
UBE2V1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51466-ACGLN
UBE2V1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51466-ACG
UBE2V1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51466-ANG
UBE2V1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51466-ACR
UBE2V1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51466-ANR
UBE2V1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51466-CF
UBE2V1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51466-NF
UBE2V1 cDNA ORF Clone, Mouse, C-His tag MG51466-CH
UBE2V1 cDNA ORF Clone, Mouse, N-His tag MG51466-NH
UBE2V1 cDNA ORF Clone, Mouse, C-HA tag MG51466-CY
UBE2V1 cDNA ORF Clone, Mouse, N-HA tag MG51466-NY
UBE2V1 cDNA ORF Clone, Mouse, C-Myc tag MG51466-CM
UBE2V1 qPCR Primer Pairs, Mouse MP201350

UBE2V1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBE2V1 cDNA ORF Clone in Cloning Vector, Human HG17115-U
UBE2V1 cDNA ORF Clone, Human, untagged HG17115-UT
UBE2V1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17115-ACG
UBE2V1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17115-ACGLN
UBE2V1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17115-ANG
UBE2V1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17115-ACR
UBE2V1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17115-ANR
UBE2V1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17115-CF
UBE2V1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17115-NF
UBE2V1 cDNA ORF Clone, Human, C-His tag HG17115-CH
UBE2V1 cDNA ORF Clone, Human, N-His tag HG17115-NH
UBE2V1 cDNA ORF Clone, Human, C-HA tag HG17115-CY
UBE2V1 cDNA ORF Clone, Human, N-HA tag HG17115-NY
UBE2V1 cDNA ORF Clone, Human, C-Myc tag HG17115-CM
UBE2V1 cDNA ORF Clone, Human, N-Myc tag HG17115-NM
info info
添加购物车成功! 添加购物车失败!