UBB cDNA ORF Clone, Mouse, untagged

Cat: MG51353-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All UBB Reagents

CRO Services

Product recommended


All UBB Reagents

UBB cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
918 bp
Description
Full length Clone DNA of Mouse ubiquitin B.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBB cDNA ORF Clone, Mouse, untagged Alternative Names

AL033289 cDNA ORF Clone, Mouse;Rps27a cDNA ORF Clone, Mouse;Uba52 cDNA ORF Clone, Mouse;Ubb2 cDNA ORF Clone, Mouse;Ubc cDNA ORF Clone, Mouse

UBB Background Information

Full Name
ubiquitin B

UBB cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
UBB cDNA ORF Clone in Cloning Vector, Rabbit TG65139-G
UBB cDNA ORF Clone, Rabbit, untagged TG65139-UT
UBB Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65139-ACGLN
UBB cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65139-ACG
UBB cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65139-ANG
UBB cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65139-ACR
UBB cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65139-ANR
UBB cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65139-CF
UBB cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65139-NF
UBB cDNA ORF Clone, Rabbit, C-His tag TG65139-CH
UBB cDNA ORF Clone, Rabbit, N-His tag TG65139-NH
UBB cDNA ORF Clone, Rabbit, C-HA tag TG65139-CY
UBB cDNA ORF Clone, Rabbit, N-HA tag TG65139-NY
UBB cDNA ORF Clone, Rabbit, C-Myc tag TG65139-CM
UBB cDNA ORF Clone, Rabbit, N-Myc tag TG65139-NM

UBB cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UBB cDNA ORF Clone in Cloning Vector, Rat RG80692-U
UBB cDNA ORF Clone, Rat, untagged RG80692-UT
UBB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80692-ACGLN
UBB cDNA ORF Clone, Rat, C-GFPSpark® tag RG80692-ACG
UBB cDNA ORF Clone, Rat, N-GFPSpark® tag RG80692-ANG
UBB cDNA ORF Clone, Rat, C-OFPSpark® tag RG80692-ACR
UBB cDNA ORF Clone, Rat, N-OFPSpark® tag RG80692-ANR
UBB cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80692-CF
UBB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80692-NF
UBB cDNA ORF Clone, Rat, C-His tag RG80692-CH
UBB cDNA ORF Clone, Rat, N-His tag RG80692-NH
UBB cDNA ORF Clone, Rat, C-HA tag RG80692-CY
UBB cDNA ORF Clone, Rat, N-HA tag RG80692-NY
UBB cDNA ORF Clone, Rat, C-Myc tag RG80692-CM
UBB cDNA ORF Clone, Rat, N-Myc tag RG80692-NM
UBB qPCR Primer Pairs, Rat RP300656

UBB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBB cDNA ORF Clone in Cloning Vector, Mouse MG51353-U
UBB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51353-ACG
UBB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51353-ACGLN
UBB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51353-ANG
UBB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51353-ACR
UBB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51353-ANR
UBB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51353-CF
UBB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51353-NF
UBB cDNA ORF Clone, Mouse, C-His tag MG51353-CH
UBB cDNA ORF Clone, Mouse, N-His tag MG51353-NH
UBB cDNA ORF Clone, Mouse, C-HA tag MG51353-CY
UBB cDNA ORF Clone, Mouse, N-HA tag MG51353-NY
UBB cDNA ORF Clone, Mouse, C-Myc tag MG51353-CM
UBB cDNA ORF Clone, Mouse, N-Myc tag MG51353-NM
UBB qPCR Primer Pairs, Mouse MP201230

UBB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBB cDNA ORF Clone in Cloning Vector, Human HG16831-U
UBB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16831-ACGLN
UBB cDNA ORF Clone, Human, N-HA tag HG16831-NY
info info
添加购物车成功! 添加购物车失败!