beta-III Tubulin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51063-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All beta-III Tubulin Reagents

CRO Services

Product recommended


All beta-III Tubulin Reagents

beta-III Tubulin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1353 bp
Description
Full length Clone DNA of Mouse tubulin, beta 3 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

beta-III Tubulin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names

3200002H15Rik cDNA ORF Clone, Mouse;M(beta)3 cDNA ORF Clone, Mouse;M(beta)6 cDNA ORF Clone, Mouse

beta-III Tubulin Background Information

Full Name
tubulin, beta 3 class III

beta-III Tubulin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
beta-III Tubulin cDNA ORF Clone in Cloning Vector, Rat RG80969-U
beta-III Tubulin cDNA ORF Clone, Rat, untagged RG80969-UT
beta-III Tubulin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80969-ACG
beta-III Tubulin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80969-ACGLN
beta-III Tubulin cDNA ORF Clone, Rat, N-GFPSpark® tag RG80969-ANG
beta-III Tubulin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80969-ACR
beta-III Tubulin cDNA ORF Clone, Rat, N-OFPSpark® tag RG80969-ANR
beta-III Tubulin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80969-CF
beta-III Tubulin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80969-NF
beta-III Tubulin cDNA ORF Clone, Rat, C-His tag RG80969-CH
beta-III Tubulin cDNA ORF Clone, Rat, N-His tag RG80969-NH
beta-III Tubulin cDNA ORF Clone, Rat, C-HA tag RG80969-CY
beta-III Tubulin cDNA ORF Clone, Rat, N-HA tag RG80969-NY
beta-III Tubulin cDNA ORF Clone, Rat, C-Myc tag RG80969-CM
beta-III Tubulin cDNA ORF Clone, Rat, N-Myc tag RG80969-NM
beta-III Tubulin qPCR Primer Pairs, Rat RP300933

beta-III Tubulin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
beta-III Tubulin cDNA ORF Clone in Cloning Vector, Mouse MG51063-G
beta-III Tubulin cDNA ORF Clone, Mouse, untagged MG51063-UT
beta-III Tubulin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51063-ACGLN
beta-III Tubulin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51063-ACG
beta-III Tubulin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51063-ANG
beta-III Tubulin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51063-ACR
beta-III Tubulin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51063-ANR
beta-III Tubulin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51063-CF
beta-III Tubulin cDNA ORF Clone, Mouse, C-His tag MG51063-CH
beta-III Tubulin cDNA ORF Clone, Mouse, N-His tag MG51063-NH
beta-III Tubulin cDNA ORF Clone, Mouse, C-HA tag MG51063-CY
beta-III Tubulin cDNA ORF Clone, Mouse, N-HA tag MG51063-NY
beta-III Tubulin cDNA ORF Clone, Mouse, C-Myc tag MG51063-CM
beta-III Tubulin cDNA ORF Clone, Mouse, N-Myc tag MG51063-NM
beta-III Tubulin qPCR Primer Pairs, Mouse MP201020

beta-III Tubulin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
beta-III Tubulin cDNA ORF Clone in Cloning Vector, Human HG13121-G
beta-III Tubulin cDNA ORF Clone, Human, untagged HG13121-UT
beta-III Tubulin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13121-ACGLN
beta-III Tubulin cDNA ORF Clone, Human, C-GFPSpark® tag HG13121-ACG
beta-III Tubulin cDNA ORF Clone, Human, N-GFPSpark® tag HG13121-ANG
beta-III Tubulin cDNA ORF Clone, Human, C-OFPSpark® tag HG13121-ACR
beta-III Tubulin cDNA ORF Clone, Human, N-OFPSpark® tag HG13121-ANR
beta-III Tubulin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13121-CF
beta-III Tubulin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13121-NF
beta-III Tubulin cDNA ORF Clone, Human, C-His tag HG13121-CH
beta-III Tubulin cDNA ORF Clone, Human, N-His tag HG13121-NH
beta-III Tubulin cDNA ORF Clone, Human, C-HA tag HG13121-CY
beta-III Tubulin cDNA ORF Clone, Human, N-HA tag HG13121-NY
beta-III Tubulin cDNA ORF Clone, Human, C-Myc tag HG13121-CM
beta-III Tubulin cDNA ORF Clone, Human, N-Myc tag HG13121-NM
beta-III Tubulin qPCR Primer Pairs, Human HP101742
info info
添加购物车成功! 添加购物车失败!