RG9MTD1 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51710-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All RG9MTD1 Reagents

CRO Services

Product recommended


All RG9MTD1 Reagents

RG9MTD1 cDNA ORF Clone, Mouse, C-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1245 bp
Description
Full length Clone DNA of Mouse tRNA methyltransferase 10C with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RG9MTD1 cDNA ORF Clone, Mouse, C-His tag Alternative Names

1300018J16Rik cDNA ORF Clone, Mouse;D16Ertd454e cDNA ORF Clone, Mouse;Rg9mtd1 cDNA ORF Clone, Mouse;Rnmtd1 cDNA ORF Clone, Mouse

RG9MTD1 Background Information

Full Name
tRNA methyltransferase 10 homolog C (S. cerevisiae)

RG9MTD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RG9MTD1 cDNA ORF Clone in Cloning Vector, Mouse MG51710-G
RG9MTD1 cDNA ORF Clone, Mouse, untagged MG51710-UT
RG9MTD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51710-ACGLN
RG9MTD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51710-ACG
RG9MTD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51710-ANG
RG9MTD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51710-ACR
RG9MTD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51710-ANR
RG9MTD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51710-CF
RG9MTD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51710-NF
RG9MTD1 cDNA ORF Clone, Mouse, N-His tag MG51710-NH
RG9MTD1 cDNA ORF Clone, Mouse, C-HA tag MG51710-CY
RG9MTD1 cDNA ORF Clone, Mouse, N-HA tag MG51710-NY
RG9MTD1 cDNA ORF Clone, Mouse, C-Myc tag MG51710-CM
RG9MTD1 cDNA ORF Clone, Mouse, N-Myc tag MG51710-NM
RG9MTD1 qPCR Primer Pairs, Mouse MP201583

RG9MTD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RG9MTD1 cDNA ORF Clone in Cloning Vector, Human HG23514-U
RG9MTD1 cDNA ORF Clone, Human, untagged HG23514-UT
RG9MTD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG23514-ACG
RG9MTD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23514-ACGLN
RG9MTD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG23514-ANG
RG9MTD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG23514-ACR
RG9MTD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG23514-ANR
RG9MTD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23514-CF
RG9MTD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23514-NF
RG9MTD1 cDNA ORF Clone, Human, C-His tag HG23514-CH
RG9MTD1 cDNA ORF Clone, Human, N-His tag HG23514-NH
RG9MTD1 cDNA ORF Clone, Human, C-HA tag HG23514-CY
RG9MTD1 cDNA ORF Clone, Human, N-HA tag HG23514-NY
RG9MTD1 cDNA ORF Clone, Human, C-Myc tag HG23514-CM
RG9MTD1 cDNA ORF Clone, Human, N-Myc tag HG23514-NM
info info
添加购物车成功! 添加购物车失败!