TMOD1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52595-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TMOD1 Reagents
CRO Services
Product recommended

All TMOD1 Reagents
TMOD1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Description
Full length Clone DNA of Mouse tropomodulin 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMOD1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
E-Tmod cDNA ORF Clone, Mouse;Tmod cDNA ORF Clone, Mouse
TMOD1 Background Information
Full Name
tropomodulin 1

TMOD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMOD1 cDNA ORF Clone in Cloning Vector, Mouse MG52595-U
TMOD1 cDNA ORF Clone, Mouse, untagged MG52595-UT
TMOD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52595-ACG
TMOD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52595-ACGLN
TMOD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52595-ANG
TMOD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52595-ACR
TMOD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52595-ANR
TMOD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52595-CF
TMOD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52595-NF
TMOD1 cDNA ORF Clone, Mouse, C-His tag MG52595-CH
TMOD1 cDNA ORF Clone, Mouse, N-His tag MG52595-NH
TMOD1 cDNA ORF Clone, Mouse, C-HA tag MG52595-CY
TMOD1 cDNA ORF Clone, Mouse, N-HA tag MG52595-NY
TMOD1 cDNA ORF Clone, Mouse, C-Myc tag MG52595-CM
TMOD1 qPCR Primer Pairs, Mouse MP202466

TMOD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMOD1 cDNA ORF Clone in Cloning Vector, Human HG15494-G
TMOD1 cDNA ORF Clone, Human, untagged HG15494-UT
TMOD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15494-ACGLN
TMOD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15494-ACG
TMOD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15494-ANG
TMOD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15494-ACR
TMOD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15494-ANR
TMOD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15494-CF
TMOD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15494-NF
TMOD1 cDNA ORF Clone, Human, C-His tag HG15494-CH
TMOD1 cDNA ORF Clone, Human, N-His tag HG15494-NH
TMOD1 cDNA ORF Clone, Human, C-HA tag HG15494-CY
TMOD1 cDNA ORF Clone, Human, N-HA tag HG15494-NY
TMOD1 cDNA ORF Clone, Human, C-Myc tag HG15494-CM
TMOD1 cDNA ORF Clone, Human, N-Myc tag HG15494-NM
TMOD1 qPCR Primer Pairs, Human HP104116
info info
添加购物车成功! 添加购物车失败!