TCP1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51966-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TCP1 Reagents

CRO Services

Product recommended


All TCP1 Reagents

TCP1 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1671 bp
Description
Full length Clone DNA of Mouse t-complex protein 1 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TCP1 cDNA ORF Clone, Mouse, N-His tag Alternative Names

AI528772 cDNA ORF Clone, Mouse;c-cpn cDNA ORF Clone, Mouse;CCT cDNA ORF Clone, Mouse;Cct1 cDNA ORF Clone, Mouse;Ccta cDNA ORF Clone, Mouse;p63 cDNA ORF Clone, Mouse;Tcp-1 cDNA ORF Clone, Mouse;Tp63 cDNA ORF Clone, Mouse;TRic cDNA ORF Clone, Mouse

TCP1 Background Information

Full Name
t-complex 1

TCP1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
TCP1 cDNA ORF Clone in Cloning Vector, Ferret FG60155-G
TCP1 cDNA ORF Clone, Ferret, untagged FG60155-UT
TCP1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60155-ACGLN
TCP1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60155-ACG
TCP1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60155-ANG
TCP1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60155-ACR
TCP1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60155-ANR
TCP1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60155-CF
TCP1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60155-NF
TCP1 cDNA ORF Clone, Ferret, C-His tag FG60155-CH
TCP1 cDNA ORF Clone, Ferret, N-His tag FG60155-NH
TCP1 cDNA ORF Clone, Ferret, C-HA tag FG60155-CY
TCP1 cDNA ORF Clone, Ferret, N-HA tag FG60155-NY
TCP1 cDNA ORF Clone, Ferret, C-Myc tag FG60155-CM
TCP1 cDNA ORF Clone, Ferret, N-Myc tag FG60155-NM

TCP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TCP1 cDNA ORF Clone in Cloning Vector, Rat RG80543-U
TCP1 cDNA ORF Clone, Rat, untagged RG80543-UT
TCP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80543-ACGLN
TCP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80543-ACG
TCP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80543-ANG
TCP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80543-ACR
TCP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80543-ANR
TCP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80543-CF
TCP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80543-NF
TCP1 cDNA ORF Clone, Rat, C-His tag RG80543-CH
TCP1 cDNA ORF Clone, Rat, N-His tag RG80543-NH
TCP1 cDNA ORF Clone, Rat, C-HA tag RG80543-CY
TCP1 cDNA ORF Clone, Rat, N-HA tag RG80543-NY
TCP1 cDNA ORF Clone, Rat, C-Myc tag RG80543-CM
TCP1 cDNA ORF Clone, Rat, N-Myc tag RG80543-NM
TCP1 qPCR Primer Pairs, Rat RP300507

TCP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TCP1 cDNA ORF Clone in Cloning Vector, Mouse MG51966-U
TCP1 cDNA ORF Clone, Mouse, untagged MG51966-UT
TCP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51966-ACG
TCP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51966-ACGLN
TCP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51966-ANG
TCP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51966-ACR
TCP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51966-ANR
TCP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51966-CF
TCP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51966-NF
TCP1 cDNA ORF Clone, Mouse, C-His tag MG51966-CH
TCP1 cDNA ORF Clone, Mouse, C-HA tag MG51966-CY
TCP1 cDNA ORF Clone, Mouse, N-HA tag MG51966-NY
TCP1 cDNA ORF Clone, Mouse, C-Myc tag MG51966-CM
TCP1 cDNA ORF Clone, Mouse, N-Myc tag MG51966-NM
TCP1 qPCR Primer Pairs, Mouse MP201839

TCP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TCP1 cDNA ORF Clone in Cloning Vector, Human HG16327-G
TCP1 cDNA ORF Clone, Human, untagged HG16327-UT
TCP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16327-ACGLN
TCP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16327-ACG
TCP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16327-ANG
TCP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16327-ACR
TCP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16327-ANR
TCP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16327-CF
TCP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16327-NF
TCP1 cDNA ORF Clone, Human, C-His tag HG16327-CH
TCP1 cDNA ORF Clone, Human, N-His tag HG16327-NH
TCP1 cDNA ORF Clone, Human, C-HA tag HG16327-CY
TCP1 cDNA ORF Clone, Human, N-HA tag HG16327-NY
TCP1 cDNA ORF Clone, Human, C-Myc tag HG16327-CM
TCP1 cDNA ORF Clone, Human, N-Myc tag HG16327-NM
TCP1 qPCR Primer Pairs, Human HP105080
info info
添加购物车成功! 添加购物车失败!