STXBP2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52750-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All STXBP2 Reagents
CRO Services
Product recommended

All STXBP2 Reagents
STXBP2 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1782 bp
Description
Full length Clone DNA of Mouse syntaxin binding protein 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STXBP2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
C79054 cDNA ORF Clone, Mouse;Munc-18-2 cDNA ORF Clone, Mouse;Munc-18b cDNA ORF Clone, Mouse;Munc18b cDNA ORF Clone, Mouse;muSec1 cDNA ORF Clone, Mouse;Sxtbp2 cDNA ORF Clone, Mouse;Sxtp2 cDNA ORF Clone, Mouse;Unc18-2 cDNA ORF Clone, Mouse;Unc18b cDNA ORF Clone, Mouse
STXBP2 Background Information
Full Name
syntaxin binding protein 2

STXBP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STXBP2 cDNA ORF Clone in Cloning Vector, Mouse MG52750-G
STXBP2 cDNA ORF Clone, Mouse, untagged MG52750-UT
STXBP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52750-ACGLN
STXBP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52750-ACG
STXBP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52750-ACR
STXBP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52750-CF
STXBP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52750-NF
STXBP2 cDNA ORF Clone, Mouse, C-His tag MG52750-CH
STXBP2 cDNA ORF Clone, Mouse, N-His tag MG52750-NH
STXBP2 cDNA ORF Clone, Mouse, C-HA tag MG52750-CY
STXBP2 cDNA ORF Clone, Mouse, N-HA tag MG52750-NY
STXBP2 cDNA ORF Clone, Mouse, N-Myc tag MG52750-NM

STXBP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STXBP2 cDNA ORF Clone in Cloning Vector, Human HG11538-G
STXBP2 cDNA ORF Clone, Human, untagged HG11538-UT
STXBP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11538-ACG
STXBP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11538-ACGLN
STXBP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11538-ANG
STXBP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11538-ACR
STXBP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11538-ANR
STXBP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11538-CF
STXBP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11538-NF
STXBP2 cDNA ORF Clone, Human, C-His tag HG11538-CH
STXBP2 cDNA ORF Clone, Human, N-His tag HG11538-NH
STXBP2 cDNA ORF Clone, Human, C-HA tag HG11538-CY
STXBP2 cDNA ORF Clone, Human, N-HA tag HG11538-NY
STXBP2 cDNA ORF Clone, Human, C-Myc tag HG11538-CM
STXBP2 cDNA ORF Clone, Human, N-Myc tag HG11538-NM
STXBP2 qPCR Primer Pairs, Human HP101668
info info
添加购物车成功! 添加购物车失败!