STAT5a cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51117-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All STAT5a Reagents

CRO Services

Product recommended


All STAT5a Reagents

STAT5a cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2382 bp
Description
Full length Clone DNA of Mouse signal transducer and activator of transcription 5A with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STAT5a cDNA ORF Clone, Mouse, C-HA tag Alternative Names

AA959963 cDNA ORF Clone, Mouse;STAT5 cDNA ORF Clone, Mouse

STAT5a Background Information

Full Name
signal transducer and activator of transcription 5A

STAT5a cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STAT5a cDNA ORF Clone in Cloning Vector, Mouse MG51117-G
STAT5a cDNA ORF Clone, Mouse, untagged MG51117-UT
STAT5a cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51117-ACG
STAT5a Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51117-ACGLN
STAT5a cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51117-ANG
STAT5a cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51117-ACR
STAT5a cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51117-ANR
STAT5a cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51117-CF
STAT5a cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51117-NF
STAT5a cDNA ORF Clone, Mouse, C-His tag MG51117-CH
STAT5a cDNA ORF Clone, Mouse, N-His tag MG51117-NH
STAT5a cDNA ORF Clone, Mouse, N-HA tag MG51117-NY
STAT5a cDNA ORF Clone, Mouse, C-Myc tag MG51117-CM
STAT5a cDNA ORF Clone, Mouse, N-Myc tag MG51117-NM
STAT5a qPCR Primer Pairs, Mouse MP201068

STAT5a cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STAT5a cDNA ORF Clone in Cloning Vector, Human HG10035-M
STAT5a cDNA ORF Clone, Human, untagged HG10035-UT
STAT5a cDNA ORF Clone, Human, C-GFPSpark® tag HG10035-ACG
STAT5a Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10035-ACGLN
STAT5a cDNA ORF Clone, Human, N-GFPSpark® tag HG10035-ANG
STAT5a cDNA ORF Clone, Human, C-OFPSpark® tag HG10035-ACR
STAT5a cDNA ORF Clone, Human, N-OFPSpark® tag HG10035-ANR
STAT5a cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10035-CF
STAT5a cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10035-NF
STAT5a cDNA ORF Clone, Human, C-His tag HG10035-CH
STAT5a cDNA ORF Clone, Human, N-His tag HG10035-NH
STAT5a cDNA ORF Clone, Human, C-HA tag HG10035-CY
STAT5a cDNA ORF Clone, Human, N-HA tag HG10035-NY
STAT5a cDNA ORF Clone, Human, C-Myc tag HG10035-CM
STAT5a cDNA ORF Clone, Human, N-Myc tag HG10035-NM
STAT5a qPCR Primer Pairs, Human HP100129
info info
添加购物车成功! 添加购物车失败!