ST13 cDNA ORF Clone, Mouse, untagged

Cat: MG52461-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ST13 Reagents

CRO Services

Product recommended


All ST13 Reagents

ST13 cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1116 bp
Description
Full length Clone DNA of Mouse suppression of tumorigenicity 13.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ST13 cDNA ORF Clone, Mouse, untagged Alternative Names

1110007I03Rik cDNA ORF Clone, Mouse;3110002K08Rik cDNA ORF Clone, Mouse;AW555194 cDNA ORF Clone, Mouse;HIP cDNA ORF Clone, Mouse;HOP cDNA ORF Clone, Mouse;HSPABP cDNA ORF Clone, Mouse;HSPABP1 cDNA ORF Clone, Mouse;p48 cDNA ORF Clone, Mouse;PRO0786 cDNA ORF Clone, Mouse;SNC6 cDNA ORF Clone, Mouse

ST13 Background Information

Full Name
suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)

ST13 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ST13 cDNA ORF Clone in Cloning Vector, Rat RG83634-U
ST13 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83634-ACGLN

ST13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ST13 cDNA ORF Clone in Cloning Vector, Mouse MG52461-G
ST13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52461-ACG
ST13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52461-ACGLN
ST13 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52461-ANG
ST13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52461-ACR
ST13 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52461-ANR
ST13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52461-CF
ST13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52461-NF
ST13 cDNA ORF Clone, Mouse, C-His tag MG52461-CH
ST13 cDNA ORF Clone, Mouse, N-His tag MG52461-NH
ST13 cDNA ORF Clone, Mouse, C-HA tag MG52461-CY
ST13 cDNA ORF Clone, Mouse, N-HA tag MG52461-NY
ST13 cDNA ORF Clone, Mouse, C-Myc tag MG52461-CM
ST13 cDNA ORF Clone, Mouse, N-Myc tag MG52461-NM
ST13 qPCR Primer Pairs, Mouse MP202334

ST13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ST13 cDNA ORF Clone in Cloning Vector, Human HG18759-U
ST13 cDNA ORF Clone, Human, untagged HG18759-UT
ST13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18759-ACGLN
ST13 cDNA ORF Clone, Human, C-GFPSpark® tag HG18759-ACG
ST13 cDNA ORF Clone, Human, N-GFPSpark® tag HG18759-ANG
ST13 cDNA ORF Clone, Human, C-OFPSpark® tag HG18759-ACR
ST13 cDNA ORF Clone, Human, N-OFPSpark® tag HG18759-ANR
ST13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18759-CF
ST13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18759-NF
ST13 cDNA ORF Clone, Human, C-His tag HG18759-CH
ST13 cDNA ORF Clone, Human, N-His tag HG18759-NH
ST13 cDNA ORF Clone, Human, C-HA tag HG18759-CY
ST13 cDNA ORF Clone, Human, N-HA tag HG18759-NY
ST13 cDNA ORF Clone, Human, C-Myc tag HG18759-CM
ST13 cDNA ORF Clone, Human, N-Myc tag HG18759-NM
info info
添加购物车成功! 添加购物车失败!