Osteopontin cDNA ORF Clone, Mouse, N-His tag

Cat: MG50116-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Osteopontin Reagents
CRO Services
Product recommended

All Osteopontin Reagents
Osteopontin cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
885 bp
Description
Full length Clone DNA of Mouse secreted phosphoprotein 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Osteopontin cDNA ORF Clone, Mouse, N-His tag Alternative Names
2AR cDNA ORF Clone, Mouse;Apl-1 cDNA ORF Clone, Mouse;BNSP cDNA ORF Clone, Mouse;Bsp cDNA ORF Clone, Mouse;BSPI cDNA ORF Clone, Mouse;Eta cDNA ORF Clone, Mouse;ETA-1 cDNA ORF Clone, Mouse;OP cDNA ORF Clone, Mouse;Opn cDNA ORF Clone, Mouse;Opnl cDNA ORF Clone, Mouse;Ric cDNA ORF Clone, Mouse;Spp-1 cDNA ORF Clone, Mouse
Osteopontin Background Information

Osteopontin, also known as Secreted phosphoprotein 1, Bone sialoprotein 1, BSP-1, OPN, and SPP1, is a member of the osteopontin family and a SIBLING glycoprotein. Osteopontin has been classified as T-helper 1 cytokine and thus believed to exacerbate inflammation in several chronic inflammatory diseases, including atherosclerosis. Besides proinflammatory functions, physiologically Osteopontin is a potent inhibitor of mineralization, it prevents ectopic calcium deposits and is a potent inducible inhibitor of vascular calcification. Osteopontin is expressed and secreted by various cells, and has a role in cell adhesion, chemotaxis, prevention of apoptosis, invasion, migration and anchorage-independent growth of tumor cells. Osteopontin recruitment functions of inflammatory cells are thought to be mediated through its adhesive domains, especially the arginine-glycine-aspartate (RGD) sequence that interacts with several integrin heterodimers. Osteopontin has emerged as a potential biomarker and mediator in cardiovascular disease. In the context of atherosclerosis, OPN is generally regarded as a proinflammatory and proatherogenic molecule. However, the role of OPN in vascular calcification (VC), which is closely related to chronic and active inflammation, is that of a negative regulator because it is an inhibitor of calcification and an active inducer of decalcification. Extensive research has demonstrated the pivotal participation of Osteopontin in the regulation of cell signaling which controls neoplastic and malignant transformation. The elevated expression of Osteopontin has been observed in a variety of cancers. It has been linked with tumor metastasis and signifies a poor prognosis for the patient.

Full Name
secreted phosphoprotein 1
References
  • Scatena M, et al. (2007) Osteopontin: a multifunctional molecule regulating chronic inflammation and vascular disease. Arterioscler Thromb Vasc Biol. 27(11): 2302-9.
  • Johnston NI, et al. (2008) Osteopontin as a target for cancer therapy. Front Biosci. 13: 4361-72.
  • Cho HJ, et al. (2009) Osteopontin: a multifunctional protein at the crossroads of inflammation, atherosclerosis, and vascular calcification. Curr Atheroscler Rep. 11(3): 206-13.
  • Waller AH, et al. (2010) Osteopontin in cardiovascular disease: a potential therapeutic target. Cardiol Rev. 18(3): 125-31.
  • Shevde LA, et al. (2010) Osteopontin: an effector and an effect of tumor metastasis. Curr Mol Med. 10(1): 71-81.
  • Osteopontin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Osteopontin cDNA ORF Clone in Cloning Vector, Rat RG81203-U
    Osteopontin cDNA ORF Clone, Rat, untagged RG81203-UT
    Osteopontin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81203-ACGLN
    Osteopontin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81203-ACG
    Osteopontin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81203-ACR
    Osteopontin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81203-CF
    Osteopontin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81203-NF
    Osteopontin cDNA ORF Clone, Rat, C-His tag RG81203-CH
    Osteopontin cDNA ORF Clone, Rat, N-His tag RG81203-NH
    Osteopontin cDNA ORF Clone, Rat, C-HA tag RG81203-CY
    Osteopontin cDNA ORF Clone, Rat, N-HA tag RG81203-NY
    Osteopontin cDNA ORF Clone, Rat, C-Myc tag RG81203-CM
    Osteopontin cDNA ORF Clone, Rat, N-Myc tag RG81203-NM
    Osteopontin qPCR Primer Pairs, Rat RP301159

    Osteopontin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Osteopontin cDNA ORF Clone in Cloning Vector, Mouse MG50116-M
    Osteopontin cDNA ORF Clone, Mouse, untagged MG50116-UT
    Osteopontin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50116-ACG
    Osteopontin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50116-ACGLN
    Osteopontin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50116-ACR
    Osteopontin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50116-CF
    Osteopontin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50116-NF
    Osteopontin cDNA ORF Clone, Mouse, C-His tag MG50116-CH
    Osteopontin cDNA ORF Clone, Mouse, C-HA tag MG50116-CY
    Osteopontin cDNA ORF Clone, Mouse, N-HA tag MG50116-NY
    Osteopontin cDNA ORF Clone, Mouse, C-Myc tag MG50116-CM
    Osteopontin cDNA ORF Clone, Mouse, N-Myc tag MG50116-NM
    Osteopontin qPCR Primer Pairs, Mouse MP200146

    Osteopontin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Osteopontin cDNA ORF Clone in Cloning Vector, Human HG10352-M
    Osteopontin cDNA ORF Clone, Human, untagged HG10352-UT
    Osteopontin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10352-ACGLN
    Osteopontin cDNA ORF Clone, Human, C-GFPSpark® tag HG10352-ACG
    Osteopontin cDNA ORF Clone, Human, C-OFPSpark® tag HG10352-ACR
    Osteopontin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10352-CF
    Osteopontin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10352-NF
    Osteopontin cDNA ORF Clone, Human, C-His tag HG10352-CH
    Osteopontin cDNA ORF Clone, Human, N-His tag HG10352-NH
    Osteopontin cDNA ORF Clone, Human, C-HA tag HG10352-CY
    Osteopontin cDNA ORF Clone, Human, N-HA tag HG10352-NY
    Osteopontin cDNA ORF Clone, Human, C-Myc tag HG10352-CM
    Osteopontin cDNA ORF Clone, Human, N-Myc tag HG10352-NM
    Osteopontin qPCR Primer Pairs, Human HP100389
    info info
    添加购物车成功! 添加购物车失败!