SLC25A38 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51978-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLC25A38 Reagents
CRO Services
Product recommended

All SLC25A38 Reagents
SLC25A38 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
981 bp
Description
Full length Clone DNA of Mouse solute carrier family 25, member 38 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A38 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AV019094 cDNA ORF Clone, Mouse;BC010801 cDNA ORF Clone, Mouse
SLC25A38 Background Information
Full Name
solute carrier family 25, member 38

SLC25A38 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A38 cDNA ORF Clone in Cloning Vector, Mouse MG51978-G
SLC25A38 cDNA ORF Clone, Mouse, untagged MG51978-UT
SLC25A38 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51978-ACG
SLC25A38 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51978-ACGLN
SLC25A38 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51978-ANG
SLC25A38 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51978-ACR
SLC25A38 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51978-ANR
SLC25A38 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51978-CF
SLC25A38 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51978-NF
SLC25A38 cDNA ORF Clone, Mouse, C-His tag MG51978-CH
SLC25A38 cDNA ORF Clone, Mouse, C-HA tag MG51978-CY
SLC25A38 cDNA ORF Clone, Mouse, N-HA tag MG51978-NY
SLC25A38 cDNA ORF Clone, Mouse, C-Myc tag MG51978-CM
SLC25A38 cDNA ORF Clone, Mouse, N-Myc tag MG51978-NM
SLC25A38 qPCR Primer Pairs, Mouse MP201851

SLC25A38 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A38 cDNA ORF Clone in Cloning Vector, Human HG23508-U
SLC25A38 cDNA ORF Clone, Human, untagged HG23508-UT
SLC25A38 cDNA ORF Clone, Human, C-GFPSpark® tag HG23508-ACG
SLC25A38 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23508-ACGLN
SLC25A38 cDNA ORF Clone, Human, N-GFPSpark® tag HG23508-ANG
SLC25A38 cDNA ORF Clone, Human, C-OFPSpark® tag HG23508-ACR
SLC25A38 cDNA ORF Clone, Human, N-OFPSpark® tag HG23508-ANR
SLC25A38 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23508-CF
SLC25A38 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23508-NF
SLC25A38 cDNA ORF Clone, Human, C-His tag HG23508-CH
SLC25A38 cDNA ORF Clone, Human, N-His tag HG23508-NH
SLC25A38 cDNA ORF Clone, Human, C-HA tag HG23508-CY
SLC25A38 cDNA ORF Clone, Human, N-HA tag HG23508-NY
SLC25A38 cDNA ORF Clone, Human, C-Myc tag HG23508-CM
SLC25A38 cDNA ORF Clone, Human, N-Myc tag HG23508-NM
info info
添加购物车成功! 添加购物车失败!