RPS15 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52817-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RPS15 Reagents
CRO Services
Product recommended

All RPS15 Reagents
RPS15 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
438 bp
Description
Full length Clone DNA of Mouse ribosomal protein S15 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS15 cDNA ORF Clone, Mouse, N-His tag Alternative Names
rig cDNA ORF Clone, Mouse
RPS15 Background Information
Full Name
ribosomal protein S15

RPS15 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS15 cDNA ORF Clone in Cloning Vector, Mouse MG52817-G
RPS15 cDNA ORF Clone, Mouse, untagged MG52817-UT
RPS15 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52817-ACG
RPS15 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52817-ACGLN
RPS15 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52817-ANG
RPS15 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52817-ACR
RPS15 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52817-ANR
RPS15 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52817-CF
RPS15 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52817-NF
RPS15 cDNA ORF Clone, Mouse, C-His tag MG52817-CH
RPS15 cDNA ORF Clone, Mouse, C-HA tag MG52817-CY
RPS15 cDNA ORF Clone, Mouse, N-HA tag MG52817-NY
RPS15 cDNA ORF Clone, Mouse, C-Myc tag MG52817-CM
RPS15 cDNA ORF Clone, Mouse, N-Myc tag MG52817-NM

RPS15 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS15 cDNA ORF Clone in Cloning Vector, Human HG16853-U
RPS15 cDNA ORF Clone, Human, untagged HG16853-UT
RPS15 cDNA ORF Clone, Human, C-GFPSpark® tag HG16853-ACG
RPS15 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16853-ACGLN
RPS15 cDNA ORF Clone, Human, N-GFPSpark® tag HG16853-ANG
RPS15 cDNA ORF Clone, Human, C-OFPSpark® tag HG16853-ACR
RPS15 cDNA ORF Clone, Human, N-OFPSpark® tag HG16853-ANR
RPS15 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16853-CF
RPS15 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16853-NF
RPS15 cDNA ORF Clone, Human, C-His tag HG16853-CH
RPS15 cDNA ORF Clone, Human, N-His tag HG16853-NH
RPS15 cDNA ORF Clone, Human, C-HA tag HG16853-CY
RPS15 cDNA ORF Clone, Human, N-HA tag HG16853-NY
RPS15 cDNA ORF Clone, Human, C-Myc tag HG16853-CM
RPS15 cDNA ORF Clone, Human, N-Myc tag HG16853-NM
info info
添加购物车成功! 添加购物车失败!