RPL35 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51187-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPL35 Reagents
CRO Services
Product recommended

All RPL35 Reagents
RPL35 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
372 bp
Description
Full length Clone DNA of Mouse ribosomal protein L35 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL35 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
2410039E09Rik cDNA ORF Clone, Mouse
RPL35 Background Information
Full Name
ribosomal protein L35

RPL35 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL35 cDNA ORF Clone in Cloning Vector, Mouse MG51187-U
RPL35 cDNA ORF Clone, Mouse, untagged MG51187-UT
RPL35 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51187-ACG
RPL35 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51187-ACGLN
RPL35 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51187-ANG
RPL35 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51187-ACR
RPL35 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51187-ANR
RPL35 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51187-CF
RPL35 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51187-NF
RPL35 cDNA ORF Clone, Mouse, C-His tag MG51187-CH
RPL35 cDNA ORF Clone, Mouse, N-His tag MG51187-NH
RPL35 cDNA ORF Clone, Mouse, N-HA tag MG51187-NY
RPL35 cDNA ORF Clone, Mouse, C-Myc tag MG51187-CM
RPL35 cDNA ORF Clone, Mouse, N-Myc tag MG51187-NM
RPL35 qPCR Primer Pairs, Mouse MP201071

RPL35 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL35 cDNA ORF Clone in Cloning Vector, Human HG21242-U
RPL35 cDNA ORF Clone, Human, untagged HG21242-UT
RPL35 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21242-ACGLN
RPL35 cDNA ORF Clone, Human, C-GFPSpark® tag HG21242-ACG
RPL35 cDNA ORF Clone, Human, N-GFPSpark® tag HG21242-ANG
RPL35 cDNA ORF Clone, Human, C-OFPSpark® tag HG21242-ACR
RPL35 cDNA ORF Clone, Human, N-OFPSpark® tag HG21242-ANR
RPL35 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21242-CF
RPL35 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21242-NF
RPL35 cDNA ORF Clone, Human, C-His tag HG21242-CH
RPL35 cDNA ORF Clone, Human, N-His tag HG21242-NH
RPL35 cDNA ORF Clone, Human, C-HA tag HG21242-CY
RPL35 cDNA ORF Clone, Human, N-HA tag HG21242-NY
RPL35 cDNA ORF Clone, Human, C-Myc tag HG21242-CM
RPL35 cDNA ORF Clone, Human, N-Myc tag HG21242-NM
info info
添加购物车成功! 添加购物车失败!