REXO2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52798-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All REXO2 Reagents
CRO Services
Product recommended

All REXO2 Reagents
REXO2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
714 bp
Description
Full length Clone DNA of Mouse REX2, RNA exonuclease 2 homolog (S. cerevisiae) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

REXO2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1810038D15Rik cDNA ORF Clone, Mouse;AW107347 cDNA ORF Clone, Mouse;Sfn cDNA ORF Clone, Mouse;Smfn cDNA ORF Clone, Mouse
REXO2 Background Information
Full Name
RNA exonuclease 2

REXO2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
REXO2 cDNA ORF Clone in Cloning Vector, Rat RG8A0060-U
REXO2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0060-ACGLN

REXO2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
REXO2 cDNA ORF Clone in Cloning Vector, Mouse MG52798-G
REXO2 cDNA ORF Clone, Mouse, untagged MG52798-UT
REXO2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52798-ACGLN
REXO2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52798-ACG
REXO2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52798-ANG
REXO2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52798-ACR
REXO2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52798-ANR
REXO2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52798-NF
REXO2 cDNA ORF Clone, Mouse, C-His tag MG52798-CH
REXO2 cDNA ORF Clone, Mouse, N-His tag MG52798-NH
REXO2 cDNA ORF Clone, Mouse, C-HA tag MG52798-CY
REXO2 cDNA ORF Clone, Mouse, N-HA tag MG52798-NY
REXO2 cDNA ORF Clone, Mouse, C-Myc tag MG52798-CM
REXO2 cDNA ORF Clone, Mouse, N-Myc tag MG52798-NM

REXO2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
REXO2 cDNA ORF Clone in Cloning Vector, Human HG21682-U
REXO2 cDNA ORF Clone, Human, untagged HG21682-UT
REXO2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21682-ACGLN
REXO2 cDNA ORF Clone, Human, C-GFPSpark® tag HG21682-ACG
REXO2 cDNA ORF Clone, Human, N-GFPSpark® tag HG21682-ANG
REXO2 cDNA ORF Clone, Human, C-OFPSpark® tag HG21682-ACR
REXO2 cDNA ORF Clone, Human, N-OFPSpark® tag HG21682-ANR
REXO2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21682-CF
REXO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21682-NF
REXO2 cDNA ORF Clone, Human, C-His tag HG21682-CH
REXO2 cDNA ORF Clone, Human, N-His tag HG21682-NH
REXO2 cDNA ORF Clone, Human, C-HA tag HG21682-CY
REXO2 cDNA ORF Clone, Human, N-HA tag HG21682-NY
REXO2 cDNA ORF Clone, Human, C-Myc tag HG21682-CM
REXO2 cDNA ORF Clone, Human, N-Myc tag HG21682-NM
info info
添加购物车成功! 添加购物车失败!