PYGM cDNA ORF Clone, Mouse, untagged

Cat: MG52459-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PYGM Reagents

CRO Services

Product recommended


All PYGM Reagents

PYGM cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2529 bp
Description
Full length Clone DNA of Mouse muscle glycogen phosphorylase.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PYGM cDNA ORF Clone, Mouse, untagged Alternative Names

AI115133 cDNA ORF Clone, Mouse;PG cDNA ORF Clone, Mouse

PYGM Background Information

Full Name
phosphorylase, glycogen, muscle

PYGM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PYGM cDNA ORF Clone in Cloning Vector, Mouse MG52459-U
PYGM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52459-ACGLN
PYGM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52459-ACG
PYGM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52459-ANG
PYGM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52459-ACR
PYGM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52459-ANR
PYGM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52459-CF
PYGM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52459-NF
PYGM cDNA ORF Clone, Mouse, C-His tag MG52459-CH
PYGM cDNA ORF Clone, Mouse, N-His tag MG52459-NH
PYGM cDNA ORF Clone, Mouse, C-HA tag MG52459-CY
PYGM cDNA ORF Clone, Mouse, N-HA tag MG52459-NY
PYGM cDNA ORF Clone, Mouse, C-Myc tag MG52459-CM
PYGM cDNA ORF Clone, Mouse, N-Myc tag MG52459-NM
PYGM qPCR Primer Pairs, Mouse MP202332

PYGM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PYGM cDNA ORF Clone in Cloning Vector, Human HG18100-U
PYGM cDNA ORF Clone, Human, untagged HG18100-UT
PYGM cDNA ORF Clone, Human, C-GFPSpark® tag HG18100-ACG
PYGM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18100-ACGLN
PYGM cDNA ORF Clone, Human, N-GFPSpark® tag HG18100-ANG
PYGM cDNA ORF Clone, Human, C-OFPSpark® tag HG18100-ACR
PYGM cDNA ORF Clone, Human, N-OFPSpark® tag HG18100-ANR
PYGM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18100-CF
PYGM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18100-NF
PYGM cDNA ORF Clone, Human, C-His tag HG18100-CH
PYGM cDNA ORF Clone, Human, N-His tag HG18100-NH
PYGM cDNA ORF Clone, Human, C-HA tag HG18100-CY
PYGM cDNA ORF Clone, Human, N-HA tag HG18100-NY
PYGM cDNA ORF Clone, Human, C-Myc tag HG18100-CM
PYGM cDNA ORF Clone, Human, N-Myc tag HG18100-NM
info info
添加购物车成功! 添加购物车失败!