PYGB cDNA ORF Clone, Mouse, untagged

Cat: MG51358-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PYGB Reagents
CRO Services
Product recommended

All PYGB Reagents
PYGB cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2532 bp
Description
Full length Clone DNA of Mouse brain glycogen phosphorylase.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PYGB Background Information
Full Name
phosphorylase, glycogen; brain

PYGB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PYGB cDNA ORF Clone in Cloning Vector, Mouse MG51358-U
PYGB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51358-ACG
PYGB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51358-ACGLN
PYGB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51358-ANG
PYGB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51358-ACR
PYGB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51358-ANR
PYGB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51358-CF
PYGB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51358-NF
PYGB cDNA ORF Clone, Mouse, C-His tag MG51358-CH
PYGB cDNA ORF Clone, Mouse, N-His tag MG51358-NH
PYGB cDNA ORF Clone, Mouse, C-HA tag MG51358-CY
PYGB cDNA ORF Clone, Mouse, N-HA tag MG51358-NY
PYGB cDNA ORF Clone, Mouse, C-Myc tag MG51358-CM
PYGB cDNA ORF Clone, Mouse, N-Myc tag MG51358-NM
PYGB qPCR Primer Pairs, Mouse MP201235

PYGB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PYGB cDNA ORF Clone in Cloning Vector, Human HG15023-G
PYGB cDNA ORF Clone, Human, untagged HG15023-UT
PYGB cDNA ORF Clone, Human, C-GFPSpark® tag HG15023-ACG
PYGB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15023-ACGLN
PYGB cDNA ORF Clone, Human, N-GFPSpark® tag HG15023-ANG
PYGB cDNA ORF Clone, Human, C-OFPSpark® tag HG15023-ACR
PYGB cDNA ORF Clone, Human, N-OFPSpark® tag HG15023-ANR
PYGB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15023-CF
PYGB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15023-NF
PYGB cDNA ORF Clone, Human, C-His tag HG15023-CH
PYGB cDNA ORF Clone, Human, N-His tag HG15023-NH
PYGB cDNA ORF Clone, Human, C-HA tag HG15023-CY
PYGB cDNA ORF Clone, Human, N-HA tag HG15023-NY
PYGB cDNA ORF Clone, Human, C-Myc tag HG15023-CM
PYGB cDNA ORF Clone, Human, N-Myc tag HG15023-NM
PYGB qPCR Primer Pairs, Human HP103651
info info
添加购物车成功! 添加购物车失败!