Prolactin cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50367-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Prolactin Reagents
CRO Services
Product recommended

All Prolactin Reagents
Prolactin cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
687 bp
Description
Full length Clone DNA of Mouse prolactin with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Prolactin cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AV290867 cDNA ORF Clone, Mouse;Prl1a1 cDNA ORF Clone, Mouse
Prolactin Background Information
Full Name
prolactin
References
  • Jara LJ, et al. (2011) Prolactin and autoimmunity. Clin Rev Allergy Immunol. 40(1): 50-9.
  • Urban A, et al. (2007) Prolactin as a factor for increased platelet aggregation. Neuro Endocrinol Lett. 28(4): 518-23.
  • Charoenphandhu N, et al. (2007) Prolactin is an important regulator of intestinal calcium transport. Can J Physiol Pharmacol. 85(6): 569-81.
  • Tworoger SS, et al. (2006) Prolactin and breast cancer risk. Cancer Lett. 243(2): 160-9.
  • Ben-Jonathan N, et al. (2006) Focus on prolactin as a metabolic hormone. Trends Endocrinol Metab. 17(3): 110-6.
  • Prolactin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Prolactin cDNA ORF Clone in Cloning Vector, Mouse MG50367-M
    Prolactin cDNA ORF Clone, Mouse, untagged MG50367-UT
    Prolactin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50367-ACG
    Prolactin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50367-ACGLN
    Prolactin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50367-ACR
    Prolactin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50367-CF
    Prolactin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50367-NF
    Prolactin cDNA ORF Clone, Mouse, C-His tag MG50367-CH
    Prolactin cDNA ORF Clone, Mouse, N-His tag MG50367-NH
    Prolactin cDNA ORF Clone, Mouse, C-HA tag MG50367-CY
    Prolactin cDNA ORF Clone, Mouse, N-HA tag MG50367-NY
    Prolactin cDNA ORF Clone, Mouse, N-Myc tag MG50367-NM
    Prolactin qPCR Primer Pairs, Mouse MP200387

    Prolactin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Prolactin cDNA ORF Clone in Cloning Vector, Human HG10275-G
    Prolactin cDNA ORF Clone, Human, untagged HG10275-UT
    Prolactin cDNA ORF Clone, Human, C-GFPSpark® tag HG10275-ACG
    Prolactin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10275-ACGLN
    Prolactin cDNA ORF Clone, Human, C-OFPSpark® tag HG10275-ACR
    Prolactin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10275-CF
    Prolactin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10275-NF
    Prolactin cDNA ORF Clone, Human, C-His tag HG10275-CH
    Prolactin cDNA ORF Clone, Human, N-His tag HG10275-NH
    Prolactin cDNA ORF Clone, Human, C-HA tag HG10275-CY
    Prolactin cDNA ORF Clone, Human, N-HA tag HG10275-NY
    Prolactin cDNA ORF Clone, Human, C-Myc tag HG10275-CM
    Prolactin cDNA ORF Clone, Human, N-Myc tag HG10275-NM
    Prolactin qPCR Primer Pairs, Human HP100322
    info info
    添加购物车成功! 添加购物车失败!