Peroxiredoxin 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51862-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Peroxiredoxin 2 Reagents
CRO Services
Product recommended

All Peroxiredoxin 2 Reagents
Peroxiredoxin 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Mouse peroxiredoxin 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Peroxiredoxin 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
AL022839 cDNA ORF Clone, Mouse;Band-8 cDNA ORF Clone, Mouse;NkefB cDNA ORF Clone, Mouse;PRP cDNA ORF Clone, Mouse;PrxII cDNA ORF Clone, Mouse;Tdpx1 cDNA ORF Clone, Mouse;TDX1 cDNA ORF Clone, Mouse;Torin cDNA ORF Clone, Mouse;TPx cDNA ORF Clone, Mouse;TPx-B cDNA ORF Clone, Mouse;TR cDNA ORF Clone, Mouse;TSA cDNA ORF Clone, Mouse
Peroxiredoxin 2 Background Information

Peroxiredoxin-2, also known as Natural killer cell-enhancing factor B, NKEF-B, Thiol-specific antioxidant protein, Thioredoxin peroxidase 1, Thioredoxin-dependent peroxide reductase 1, PRDX2 and NKEFB, is a cytoplasm protein which belongs to the ahpC / TSA family. Peroxiredoxin-2 / PRDX2 contains one thioredoxin domain. Peroxiredoxin-2 / PRDX2 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-2 / PRDX2 is not able to receive electrons from glutaredoxin. It may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-2 / PRDX2 might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2.

The Peroxiredoxins / Prx are a family of peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

Full Name
peroxiredoxin 2
References
  • Cha M.-K., et al., 1995,  Biochem. Biophys. Res. Commun. 217:900-7.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Chevallet M., et al., 2003, J. Biol. Chem. 278:37146-53.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Gauci S., et al., 2009, Anal. Chem. 81:4493-501.
  • Peroxiredoxin 2 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    Peroxiredoxin 2 cDNA ORF Clone in Cloning Vector, Ferret FG60158-G
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, untagged FG60158-UT
    Peroxiredoxin 2 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60158-ACGLN
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60158-ACG
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60158-ANG
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60158-ACR
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60158-ANR
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60158-CF
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60158-NF
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, C-His tag FG60158-CH
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, N-His tag FG60158-NH
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, C-HA tag FG60158-CY
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, N-HA tag FG60158-NY
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, C-Myc tag FG60158-CM
    Peroxiredoxin 2 cDNA ORF Clone, Ferret, N-Myc tag FG60158-NM

    Peroxiredoxin 2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Peroxiredoxin 2 cDNA ORF Clone in Cloning Vector, Canine DG70173-U
    Peroxiredoxin 2 cDNA ORF Clone, Canine, untagged DG70173-UT
    Peroxiredoxin 2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70173-ACGLN
    Peroxiredoxin 2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70173-ACG
    Peroxiredoxin 2 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70173-ANG
    Peroxiredoxin 2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70173-ACR
    Peroxiredoxin 2 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70173-ANR
    Peroxiredoxin 2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70173-CF
    Peroxiredoxin 2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70173-NF
    Peroxiredoxin 2 cDNA ORF Clone, Canine, C-His tag DG70173-CH
    Peroxiredoxin 2 cDNA ORF Clone, Canine, N-His tag DG70173-NH
    Peroxiredoxin 2 cDNA ORF Clone, Canine, C-HA tag DG70173-CY
    Peroxiredoxin 2 cDNA ORF Clone, Canine, N-HA tag DG70173-NY
    Peroxiredoxin 2 cDNA ORF Clone, Canine, C-Myc tag DG70173-CM
    Peroxiredoxin 2 cDNA ORF Clone, Canine, N-Myc tag DG70173-NM

    Peroxiredoxin 2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Peroxiredoxin 2 cDNA ORF Clone in Cloning Vector, Rat RG80710-U
    Peroxiredoxin 2 cDNA ORF Clone, Rat, untagged RG80710-UT
    Peroxiredoxin 2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80710-ACGLN
    Peroxiredoxin 2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80710-ACG
    Peroxiredoxin 2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80710-ANG
    Peroxiredoxin 2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80710-ACR
    Peroxiredoxin 2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80710-ANR
    Peroxiredoxin 2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80710-CF
    Peroxiredoxin 2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80710-NF
    Peroxiredoxin 2 cDNA ORF Clone, Rat, C-His tag RG80710-CH
    Peroxiredoxin 2 cDNA ORF Clone, Rat, N-His tag RG80710-NH
    Peroxiredoxin 2 cDNA ORF Clone, Rat, C-HA tag RG80710-CY
    Peroxiredoxin 2 cDNA ORF Clone, Rat, N-HA tag RG80710-NY
    Peroxiredoxin 2 cDNA ORF Clone, Rat, C-Myc tag RG80710-CM
    Peroxiredoxin 2 cDNA ORF Clone, Rat, N-Myc tag RG80710-NM
    Peroxiredoxin 2 qPCR Primer Pairs, Rat RP300674

    Peroxiredoxin 2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Peroxiredoxin 2 cDNA ORF Clone in Cloning Vector, Mouse MG51862-G
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, untagged MG51862-UT
    Peroxiredoxin 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51862-ACGLN
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51862-ACG
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51862-ANG
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51862-ACR
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51862-ANR
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51862-CF
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, C-His tag MG51862-CH
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, N-His tag MG51862-NH
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, C-HA tag MG51862-CY
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, N-HA tag MG51862-NY
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, C-Myc tag MG51862-CM
    Peroxiredoxin 2 cDNA ORF Clone, Mouse, N-Myc tag MG51862-NM
    Peroxiredoxin 2 qPCR Primer Pairs, Mouse MP201735

    Peroxiredoxin 2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Peroxiredoxin 2 cDNA ORF Clone in Cloning Vector, Human HG11255-M
    Peroxiredoxin 2 cDNA ORF Clone, Human, untagged HG11255-UT
    Peroxiredoxin 2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11255-ACGLN
    Peroxiredoxin 2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11255-ACG
    Peroxiredoxin 2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11255-ANG
    Peroxiredoxin 2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11255-ACR
    Peroxiredoxin 2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11255-ANR
    Peroxiredoxin 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11255-CF
    Peroxiredoxin 2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11255-NF
    Peroxiredoxin 2 cDNA ORF Clone, Human, C-His tag HG11255-CH
    Peroxiredoxin 2 cDNA ORF Clone, Human, N-His tag HG11255-NH
    Peroxiredoxin 2 cDNA ORF Clone, Human, C-HA tag HG11255-CY
    Peroxiredoxin 2 cDNA ORF Clone, Human, N-HA tag HG11255-NY
    Peroxiredoxin 2 cDNA ORF Clone, Human, C-Myc tag HG11255-CM
    Peroxiredoxin 2 cDNA ORF Clone, Human, N-Myc tag HG11255-NM
    Peroxiredoxin 2 qPCR Primer Pairs, Human HP101139
    info info
    添加购物车成功! 添加购物车失败!