Periostin cDNA ORF Clone, Mouse, C-His tag

Cat: MG50450-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Periostin Reagents

CRO Services

Product recommended


All Periostin Reagents

Periostin cDNA ORF Clone, Mouse, C-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2436 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 453T/A, 1452T/C, 1476A/G, 1902T/C, 2220T/C  not causing the amino acid variation.
Description
Full length Clone DNA of Mouse periostin, osteoblast specific factor with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI (two restriction sites) + XbaI (6kb + 1.78kb + 0.71kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Periostin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Periostin cDNA ORF Clone, Mouse, C-His tag Validated Images

Mouse Periostin/POSTN/OSF-2 Gene Plasmid Map 5892

Periostin cDNA ORF Clone, Mouse, C-His tag Alternative Names

A630052E07Rik cDNA ORF Clone, Mouse;AI747096 cDNA ORF Clone, Mouse;OSF-2 cDNA ORF Clone, Mouse;Osf2 cDNA ORF Clone, Mouse;peri cDNA ORF Clone, Mouse;PLF cDNA ORF Clone, Mouse;PN cDNA ORF Clone, Mouse

Periostin Background Information

Periostin ( POSTN ), also known as OSF2 (osteoblast specific factor 2), is a heterofunctional secreted extracellular matrix (ECM) protein comprised of four fasciclin domains that promotes cellular adhesion and movement, as well as collagen fibrillogenesis. Postn is expressed in unique growth centers during embryonic development where it facilitates epithelial-mesenchymal transition (EMT) of select cell populations undergoing reorganization. In the adult, Postn expression is specifically induced in areas of tissue injury or areas with ongoing cellular re-organization. In the adult heart Postn is induced in the ventricles following myocardial infarction, pressure overload stimulation, or generalized cardiomyopathy. Although the detailed function of Postn is still unclear, Postn-integrin interaction is thought to be involved in tumor development. Postn is frequently overexpressed in various types of human cancers, stimulating metastatic growth by promoting cancer cell survival, invasion and angiogenesis, and can be a useful marker to predict the behavior of cancer.

Full Name
periostin, osteoblast specific factor
References
  • Kudo,Y. et al., 2007, Histol Histopathol. 22 (10):1167-1174.
  • Li, J.S. et al., 2007, World J Gastroenterol. 13 (39): 5261-5266.
  • Oku, E. et al., 2008, Int J Hematol. 88 (1): 57-63.
  • Hamilton, D.W. et al., 2008, J Cell Commun Signal. 2(1-2):9-17.
  • Puglisi, F.J et al., 2008, Clin Pathol. 61 (4): 494-498.
  • Conway, S. J. et al., 2008, Curr Genomics. 9 (8): 548-555.
  • Periostin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Periostin cDNA ORF Clone in Cloning Vector, Mouse MG50450-M
    Periostin cDNA ORF Clone, Mouse, untagged MG50450-UT
    Periostin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50450-ACGLN
    Periostin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50450-ACG
    Periostin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50450-ACR
    Periostin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50450-CF
    Periostin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50450-NF
    Periostin cDNA ORF Clone, Mouse, N-His tag MG50450-NH
    Periostin cDNA ORF Clone, Mouse, C-HA tag MG50450-CY
    Periostin cDNA ORF Clone, Mouse, N-HA tag MG50450-NY
    Periostin cDNA ORF Clone, Mouse, C-Myc tag MG50450-CM
    Periostin cDNA ORF Clone, Mouse, N-Myc tag MG50450-NM
    Periostin qPCR Primer Pairs, Mouse MP200090

    Periostin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Periostin cDNA ORF Clone in Cloning Vector, Human HG10299-G
    Periostin cDNA ORF Clone, Human, untagged HG10299-UT
    Periostin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10299-ACGLN
    Periostin cDNA ORF Clone, Human, C-GFPSpark® tag HG10299-ACG
    Periostin cDNA ORF Clone, Human, C-OFPSpark® tag HG10299-ACR
    Periostin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10299-CF
    Periostin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10299-NF
    Periostin cDNA ORF Clone, Human, C-His tag HG10299-CH
    Periostin cDNA ORF Clone, Human, N-His tag HG10299-NH
    Periostin cDNA ORF Clone, Human, C-HA tag HG10299-CY
    Periostin cDNA ORF Clone, Human, N-HA tag HG10299-NY
    Periostin cDNA ORF Clone, Human, C-Myc tag HG10299-CM
    Periostin cDNA ORF Clone, Human, N-Myc tag HG10299-NM
    Periostin qPCR Primer Pairs, Human HP100342
    info info
    添加购物车成功! 添加购物车失败!