PLA2G4A cDNA ORF Clone, Mouse, C-His tag

Cat: MG51714-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PLA2G4A Reagents

CRO Services

Product recommended


All PLA2G4A Reagents

PLA2G4A cDNA ORF Clone, Mouse, C-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2247 bp
Description
Full length Clone DNA of Mouse phospholipase A2, group IVA (cytosolic, calcium-dependent) with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLA2G4A cDNA ORF Clone, Mouse, C-His tag Alternative Names

cPLA2 cDNA ORF Clone, Mouse;cPLA2-alpha cDNA ORF Clone, Mouse;cPLA2alpha cDNA ORF Clone, Mouse;Pla2g4 cDNA ORF Clone, Mouse

PLA2G4A Background Information

Full Name
phospholipase A2, group IVA (cytosolic, calcium-dependent)

PLA2G4A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PLA2G4A cDNA ORF Clone in Cloning Vector, Mouse MG51714-G
PLA2G4A cDNA ORF Clone, Mouse, untagged MG51714-UT
PLA2G4A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51714-ACG
PLA2G4A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51714-ACGLN
PLA2G4A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51714-ANG
PLA2G4A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51714-ACR
PLA2G4A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51714-ANR
PLA2G4A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51714-CF
PLA2G4A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51714-NF
PLA2G4A cDNA ORF Clone, Mouse, N-His tag MG51714-NH
PLA2G4A cDNA ORF Clone, Mouse, C-HA tag MG51714-CY
PLA2G4A cDNA ORF Clone, Mouse, N-HA tag MG51714-NY
PLA2G4A cDNA ORF Clone, Mouse, C-Myc tag MG51714-CM
PLA2G4A cDNA ORF Clone, Mouse, N-Myc tag MG51714-NM
PLA2G4A qPCR Primer Pairs, Mouse MP201587

PLA2G4A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PLA2G4A cDNA ORF Clone in Cloning Vector, Human HG13126-G
PLA2G4A cDNA ORF Clone, Human, untagged HG13126-UT
PLA2G4A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13126-ACGLN
PLA2G4A cDNA ORF Clone, Human, C-GFPSpark® tag HG13126-ACG
PLA2G4A cDNA ORF Clone, Human, N-GFPSpark® tag HG13126-ANG
PLA2G4A cDNA ORF Clone, Human, C-OFPSpark® tag HG13126-ACR
PLA2G4A cDNA ORF Clone, Human, N-OFPSpark® tag HG13126-ANR
PLA2G4A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13126-CF
PLA2G4A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13126-NF
PLA2G4A cDNA ORF Clone, Human, C-His tag HG13126-CH
PLA2G4A cDNA ORF Clone, Human, N-His tag HG13126-NH
PLA2G4A cDNA ORF Clone, Human, C-HA tag HG13126-CY
PLA2G4A cDNA ORF Clone, Human, N-HA tag HG13126-NY
PLA2G4A cDNA ORF Clone, Human, C-Myc tag HG13126-CM
PLA2G4A cDNA ORF Clone, Human, N-Myc tag HG13126-NM
PLA2G4A qPCR Primer Pairs, Human HP101746
info info
添加购物车成功! 添加购物车失败!