PILRB cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50219-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PILRB Reagents
CRO Services
Product recommended

All PILRB Reagents
PILRB cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Mouse paired immunoglobin-like type 2 receptor beta 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PILRB cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Fdact cDNA ORF Clone, Mouse;FDFACT cDNA ORF Clone, Mouse;Pilrb cDNA ORF Clone, Mouse
PILRB Background Information
Full Name
paired immunoglobin-like type 2 receptor beta
References
  • Wilson MD, et al. (2006) Comparative analysis of the paired immunoglobulin-like receptor (PILR) locus in six mammalian genomes: duplication, conversion, and the birth of new genes. Physiol Genomics. 27 (3): 201-18.
  • Orr MT, et al. (2010) Natural killer cell education and tolerance. Cell. 142(6): 847-56.
  • Mousseau DD, et al. (2000) PILRalpha, a novel immunoreceptor tyrosine-based inhibitory motif-bearing protein, recruits SHP-1 upon tyrosine phosphorylation and is paired with the truncated counterpart PILRbeta. J Biol Chem. 275 (6): 4467-74.
  • PILRB cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PILRB cDNA ORF Clone in Cloning Vector, Mouse MG50219-M
    PILRB cDNA ORF Clone, Mouse, untagged MG50219-UT
    PILRB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50219-ACGLN
    PILRB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50219-ACG
    PILRB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50219-ACR
    PILRB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50219-CF
    PILRB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50219-NF
    PILRB cDNA ORF Clone, Mouse, C-His tag MG50219-CH
    PILRB cDNA ORF Clone, Mouse, N-His tag MG50219-NH
    PILRB cDNA ORF Clone, Mouse, C-HA tag MG50219-CY
    PILRB cDNA ORF Clone, Mouse, N-HA tag MG50219-NY
    PILRB cDNA ORF Clone, Mouse, C-Myc tag MG50219-CM
    PILRB qPCR Primer Pairs, Mouse MP200246

    PILRB cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PILRB cDNA ORF Clone in Cloning Vector, Human HG13746-G
    PILRB cDNA ORF Clone, Human, untagged HG13746-UT
    PILRB cDNA ORF Clone, Human, C-GFPSpark® tag HG13746-ACG
    PILRB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13746-ACGLN
    PILRB cDNA ORF Clone, Human, C-OFPSpark® tag HG13746-ACR
    PILRB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13746-CF
    PILRB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13746-NF
    PILRB cDNA ORF Clone, Human, C-His tag HG13746-CH
    PILRB cDNA ORF Clone, Human, N-His tag HG13746-NH
    PILRB cDNA ORF Clone, Human, C-HA tag HG13746-CY
    PILRB cDNA ORF Clone, Human, N-HA tag HG13746-NY
    PILRB cDNA ORF Clone, Human, C-Myc tag HG13746-CM
    PILRB cDNA ORF Clone, Human, N-Myc tag HG13746-NM
    PILRB qPCR Primer Pairs, Human HP102423
    info info
    添加购物车成功! 添加购物车失败!