AGXT2L2 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG51996-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All AGXT2L2 Reagents

CRO Services

Product recommended


All AGXT2L2 Reagents

AGXT2L2 cDNA ORF Clone, Mouse, N-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Description
Full length Clone DNA of Mouse 5-phosphohydroxy-L-lysine phospholyase with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AGXT2L2 cDNA ORF Clone, Mouse, N-HA tag Alternative Names

2900006B13Rik cDNA ORF Clone, Mouse;Agxt2l2 cDNA ORF Clone, Mouse

AGXT2L2 Background Information

Full Name
5-phosphohydroxy-L-lysine phospho-lyase

AGXT2L2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AGXT2L2 cDNA ORF Clone in Cloning Vector, Mouse MG51996-G
AGXT2L2 cDNA ORF Clone, Mouse, untagged MG51996-UT
AGXT2L2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51996-ACGLN
AGXT2L2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51996-ACG
AGXT2L2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51996-ANG
AGXT2L2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51996-ACR
AGXT2L2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51996-ANR
AGXT2L2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51996-CF
AGXT2L2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51996-NF
AGXT2L2 cDNA ORF Clone, Mouse, C-His tag MG51996-CH
AGXT2L2 cDNA ORF Clone, Mouse, N-His tag MG51996-NH
AGXT2L2 cDNA ORF Clone, Mouse, C-HA tag MG51996-CY
AGXT2L2 cDNA ORF Clone, Mouse, C-Myc tag MG51996-CM
AGXT2L2 cDNA ORF Clone, Mouse, N-Myc tag MG51996-NM
AGXT2L2 qPCR Primer Pairs, Mouse MP201869

AGXT2L2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AGXT2L2 cDNA ORF Clone in Cloning Vector, Human HG24190-U
AGXT2L2 cDNA ORF Clone in Cloning Vector, Human HG14579-G
AGXT2L2 cDNA ORF Clone, Human, untagged HG14579-UT
AGXT2L2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14579-ACGLN
AGXT2L2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14579-ACG
AGXT2L2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14579-ANG
AGXT2L2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14579-ACR
AGXT2L2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14579-ANR
AGXT2L2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14579-CF
AGXT2L2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14579-NF
AGXT2L2 cDNA ORF Clone, Human, C-His tag HG14579-CH
AGXT2L2 cDNA ORF Clone, Human, N-His tag HG14579-NH
AGXT2L2 cDNA ORF Clone, Human, C-HA tag HG14579-CY
AGXT2L2 cDNA ORF Clone, Human, N-HA tag HG14579-NY
AGXT2L2 cDNA ORF Clone, Human, C-Myc tag HG14579-CM
AGXT2L2 cDNA ORF Clone, Human, N-Myc tag HG14579-NM
AGXT2L2 qPCR Primer Pairs, Human HP103215
info info
添加购物车成功! 添加购物车失败!