PGF cDNA ORF Clone, Mouse, N-His tag

Cat: MG50125-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PGF Reagents
CRO Services
Product recommended

All PGF Reagents
PGF cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
477 bp
Description
Full length Clone DNA of Mouse placental growth factor with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PGF cDNA ORF Clone, Mouse, N-His tag Alternative Names
AI854365 cDNA ORF Clone, Mouse;PIGF cDNA ORF Clone, Mouse;Plgf cDNA ORF Clone, Mouse
PGF Background Information
Full Name
placental growth factor
References
  • Nagy JA, et al. (2003) VEGF-A(164/165) and PLGF: roles in angiogenesis and arteriogenesis. Trends Cardiovasc Med. 13(5): 169-75.
  • Chaballe L, et al. (2011) Placental growth factor: a tissue modelling factor with therapeutic potentials in neurology? Acta Neurol Belg. 111(1): 10-7.
  • Odorisio T, et al. (2006) The placental growth factor in skin angiogenesis. J Dermatol Sci. 41(1): 11-9.
  • PGF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PGF cDNA ORF Clone in Cloning Vector, Mouse MG50125-M
    PGF cDNA ORF Clone, Mouse, untagged MG50125-UT
    PGF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50125-ACGLN
    PGF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50125-ACG
    PGF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50125-ACR
    PGF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50125-CF
    PGF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50125-NF
    PGF cDNA ORF Clone, Mouse, C-His tag MG50125-CH
    PGF cDNA ORF Clone, Mouse, C-HA tag MG50125-CY
    PGF cDNA ORF Clone, Mouse, N-HA tag MG50125-NY
    PGF cDNA ORF Clone, Mouse, C-Myc tag MG50125-CM
    PGF cDNA ORF Clone, Mouse, N-Myc tag MG50125-NM
    PGF qPCR Primer Pairs, Mouse MP200155

    PGF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PGF cDNA ORF Clone in Cloning Vector, Human HG10274-M
    PGF cDNA ORF Clone, Human, untagged HG10274-UT
    PGF cDNA ORF Clone, Human, C-GFPSpark® tag HG10274-ACG
    PGF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10274-ACGLN
    PGF cDNA ORF Clone, Human, C-OFPSpark® tag HG10274-ACR
    PGF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10274-CF
    PGF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10274-NF
    PGF cDNA ORF Clone, Human, C-His tag HG10274-CH
    PGF cDNA ORF Clone, Human, N-His tag HG10274-NH
    PGF cDNA ORF Clone, Human, C-HA tag HG10274-CY
    PGF cDNA ORF Clone, Human, N-HA tag HG10274-NY
    PGF cDNA ORF Clone, Human, C-Myc tag HG10274-CM
    PGF cDNA ORF Clone, Human, N-Myc tag HG10274-NM
    PGF qPCR Primer Pairs, Human HP100321
    info info
    添加购物车成功! 添加购物车失败!