PDIA6 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52825-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PDIA6 Reagents
CRO Services
Product recommended

All PDIA6 Reagents
PDIA6 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1338 bp
Description
Full length Clone DNA of Mouse protein disulfide isomerase associated 6 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDIA6 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1700015E05Rik cDNA ORF Clone, Mouse;AL023058 cDNA ORF Clone, Mouse;C77895 cDNA ORF Clone, Mouse;CaBP5 cDNA ORF Clone, Mouse;P5 cDNA ORF Clone, Mouse;Txndc7 cDNA ORF Clone, Mouse
PDIA6 Background Information
Full Name
protein disulfide isomerase family A, member 6

PDIA6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PDIA6 cDNA ORF Clone in Cloning Vector, Rat RG80642-U
PDIA6 cDNA ORF Clone, Rat, untagged RG80642-UT
PDIA6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80642-ACGLN
PDIA6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80642-ACG
PDIA6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80642-ACR
PDIA6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80642-CF
PDIA6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80642-NF
PDIA6 cDNA ORF Clone, Rat, C-His tag RG80642-CH
PDIA6 cDNA ORF Clone, Rat, N-His tag RG80642-NH
PDIA6 cDNA ORF Clone, Rat, C-HA tag RG80642-CY
PDIA6 cDNA ORF Clone, Rat, N-HA tag RG80642-NY
PDIA6 cDNA ORF Clone, Rat, C-Myc tag RG80642-CM
PDIA6 cDNA ORF Clone, Rat, N-Myc tag RG80642-NM
PDIA6 qPCR Primer Pairs, Rat RP300606

PDIA6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDIA6 cDNA ORF Clone in Cloning Vector, Mouse MG52825-G
PDIA6 cDNA ORF Clone, Mouse, untagged MG52825-UT
PDIA6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52825-ACG
PDIA6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52825-ACGLN
PDIA6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52825-ACR
PDIA6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52825-CF
PDIA6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52825-NF
PDIA6 cDNA ORF Clone, Mouse, C-His tag MG52825-CH
PDIA6 cDNA ORF Clone, Mouse, C-HA tag MG52825-CY
PDIA6 cDNA ORF Clone, Mouse, N-HA tag MG52825-NY
PDIA6 cDNA ORF Clone, Mouse, C-Myc tag MG52825-CM
PDIA6 cDNA ORF Clone, Mouse, N-Myc tag MG52825-NM

PDIA6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDIA6 cDNA ORF Clone in Cloning Vector, Human HG16211-G
PDIA6 cDNA ORF Clone, Human, untagged HG16211-UT
PDIA6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16211-ACG
PDIA6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16211-ACGLN
PDIA6 cDNA ORF Clone, Human, N-GFPSpark® tag HG16211-ANG
PDIA6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16211-ACR
PDIA6 cDNA ORF Clone, Human, N-OFPSpark® tag HG16211-ANR
PDIA6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16211-CF
PDIA6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16211-NF
PDIA6 cDNA ORF Clone, Human, C-His tag HG16211-CH
PDIA6 cDNA ORF Clone, Human, N-His tag HG16211-NH
PDIA6 cDNA ORF Clone, Human, C-HA tag HG16211-CY
PDIA6 cDNA ORF Clone, Human, N-HA tag HG16211-NY
PDIA6 cDNA ORF Clone, Human, C-Myc tag HG16211-CM
PDIA6 cDNA ORF Clone, Human, N-Myc tag HG16211-NM
PDIA6 qPCR Primer Pairs, Human HP104976
info info
添加购物车成功! 添加购物车失败!