PDGFA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG50447-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PDGFA Reagents
CRO Services
Product recommended

All PDGFA Reagents
PDGFA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
591 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse platelet derived growth factor, alpha with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.62kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PDGFA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDGFA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
Mouse PDGFA/PDGF-1 Gene Expression validated Image 16261
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
PDGFA Background Information
Full Name
platelet-derived growth factor alpha polypeptide

PDGFA cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PDGFA cDNA ORF Clone in Cloning Vector, Canine DG70052-G
PDGFA cDNA ORF Clone, Canine, untagged DG70052-UT
PDGFA Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70052-ACGLN
PDGFA cDNA ORF Clone, Canine, C-GFPSpark® tag DG70052-ACG
PDGFA cDNA ORF Clone, Canine, C-OFPSpark® tag DG70052-ACR
PDGFA cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70052-CF
PDGFA cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70052-NF
PDGFA cDNA ORF Clone, Canine, C-His tag DG70052-CH
PDGFA cDNA ORF Clone, Canine, N-His tag DG70052-NH
PDGFA cDNA ORF Clone, Canine, C-HA tag DG70052-CY
PDGFA cDNA ORF Clone, Canine, N-HA tag DG70052-NY
PDGFA cDNA ORF Clone, Canine, C-Myc tag DG70052-CM
PDGFA cDNA ORF Clone, Canine, N-Myc tag DG70052-NM

PDGFA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PDGFA cDNA ORF Clone in Cloning Vector, Rat RG80068-M
PDGFA cDNA ORF Clone, Rat, untagged RG80068-UT
PDGFA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80068-ACG
PDGFA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80068-ACGLN
PDGFA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80068-ACR
PDGFA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80068-CF
PDGFA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80068-NF
PDGFA cDNA ORF Clone, Rat, C-His tag RG80068-CH
PDGFA cDNA ORF Clone, Rat, N-His tag RG80068-NH
PDGFA cDNA ORF Clone, Rat, C-HA tag RG80068-CY
PDGFA cDNA ORF Clone, Rat, N-HA tag RG80068-NY
PDGFA cDNA ORF Clone, Rat, C-Myc tag RG80068-CM
PDGFA cDNA ORF Clone, Rat, N-Myc tag RG80068-NM
PDGFA qPCR Primer Pairs, Rat RP300066

PDGFA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDGFA cDNA ORF Clone in Cloning Vector, Mouse MG50447-M
PDGFA cDNA ORF Clone, Mouse, untagged MG50447-UT
PDGFA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50447-ACGLN
PDGFA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50447-ACG
PDGFA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50447-ACR
PDGFA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50447-CF
PDGFA cDNA ORF Clone, Mouse, C-His tag MG50447-CH
PDGFA cDNA ORF Clone, Mouse, N-His tag MG50447-NH
PDGFA cDNA ORF Clone, Mouse, C-HA tag MG50447-CY
PDGFA cDNA ORF Clone, Mouse, N-HA tag MG50447-NY
PDGFA cDNA ORF Clone, Mouse, C-Myc tag MG50447-CM
PDGFA cDNA ORF Clone, Mouse, N-Myc tag MG50447-NM
PDGFA qPCR Primer Pairs, Mouse MP200456

PDGFA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDGFA cDNA ORF Clone in Cloning Vector, Human HG13081-G
PDGFA cDNA ORF Clone, Human, untagged HG13081-UT
PDGFA cDNA ORF Clone, Human, C-GFPSpark® tag HG13081-ACG
PDGFA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13081-ACGLN
PDGFA cDNA ORF Clone, Human, C-OFPSpark® tag HG13081-ACR
PDGFA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13081-CF
PDGFA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13081-NF
PDGFA cDNA ORF Clone, Human, C-His tag HG13081-CH
PDGFA cDNA ORF Clone, Human, N-His tag HG13081-NH
PDGFA cDNA ORF Clone, Human, C-HA tag HG13081-CY
PDGFA cDNA ORF Clone, Human, N-HA tag HG13081-NY
PDGFA cDNA ORF Clone, Human, C-Myc tag HG13081-CM
PDGFA cDNA ORF Clone, Human, N-Myc tag HG13081-NM
PDGFA qPCR Primer Pairs, Human HP101698
info info
添加购物车成功! 添加购物车失败!