Oncostatin M cDNA ORF Clone, Mouse, N-His tag

Cat: MG50112-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Oncostatin M Reagents
CRO Services
Product recommended

All Oncostatin M Reagents
Oncostatin M cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Mouse Oncostatin M with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Oncostatin M cDNA ORF Clone, Mouse, N-His tag Alternative Names
OncoM cDNA ORF Clone, Mouse
Oncostatin M Background Information

Oncostatin M (OSM) is a glycoprotein belonging to the interleukin-6 family of cytokines that has functions mainly in cell growth. Oncostatin M (OSM) is considered as a pleiotropic cytokine that signals through cell surface receptors typeⅠand typeⅡ both of which share the similarity of containing protein gp130 and takes part in many biometabolism processes including liver development, haematopoeisis, inflammation, bone formation and destruction and possibly CNS development. Oncostatin M (OSM) was previoustly identified by its ability to inhibit the growth of cells from melanoma and other solid tumors. It also has been reported that OSM, like LIF, IL-6 and G-CSF, has the ability to inhibit the proliferation of murine M1 myeloid leukemic cells and can induce their differentiation into macrophage-like cells. The human form of OSM is insensitive between pH2 and 11 and resistant to heating for one hour at 56 degree but is not stable at 90 degrees. The human OSM is produced as a precursor containing 252 amino acids, whose first 25 amino acids function as a secretory signal peptide and which on removal yields the soluble 227 amino acid pro-OSM. Removal of the C-teminal most 31 amino acids produces the fully active 196 residue form.

Full Name
oncostatin M
References
  • Tanaka M, et al. (2003) Oncostatin M, a multifunctional cytokine. Rev Physiol Biochem Pharmacol. Reviews of Physiology, Biochemistry and Pharmacology. 149: 39-52.
  • Auguste P, et al. (1997) Signaling of type II oncostatin M receptor. J Biol Chem. 272 (25): 15760-4.
  • Zarling JM, et al. (1986). Oncostatin M: a growth regulator produced by differentiated histiocytic lymphoma cells. Proc Natl Acad Sci. 83 (24): 9739-43.
  • Oncostatin M cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Oncostatin M cDNA ORF Clone in Cloning Vector, Mouse MG50112-M
    Oncostatin M cDNA ORF Clone, Mouse, untagged MG50112-UT
    Oncostatin M Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50112-ACGLN
    Oncostatin M cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50112-ACG
    Oncostatin M cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50112-ACR
    Oncostatin M cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50112-CF
    Oncostatin M cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50112-NF
    Oncostatin M cDNA ORF Clone, Mouse, C-His tag MG50112-CH
    Oncostatin M cDNA ORF Clone, Mouse, C-HA tag MG50112-CY
    Oncostatin M cDNA ORF Clone, Mouse, N-HA tag MG50112-NY
    Oncostatin M cDNA ORF Clone, Mouse, C-Myc tag MG50112-CM
    Oncostatin M cDNA ORF Clone, Mouse, N-Myc tag MG50112-NM
    Oncostatin M qPCR Primer Pairs, Mouse MP200142

    Oncostatin M cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Oncostatin M cDNA ORF Clone in Cloning Vector, Human HG10452-M
    Oncostatin M cDNA ORF Clone, Human, untagged HG10452-UT
    Oncostatin M cDNA ORF Clone, Human, C-GFPSpark® tag HG10452-ACG
    Oncostatin M Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10452-ACGLN
    Oncostatin M cDNA ORF Clone, Human, C-OFPSpark® tag HG10452-ACR
    Oncostatin M cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10452-CF
    Oncostatin M cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10452-NF
    Oncostatin M cDNA ORF Clone, Human, C-His tag HG10452-CH
    Oncostatin M cDNA ORF Clone, Human, N-His tag HG10452-NH
    Oncostatin M cDNA ORF Clone, Human, C-HA tag HG10452-CY
    Oncostatin M cDNA ORF Clone, Human, N-HA tag HG10452-NY
    Oncostatin M cDNA ORF Clone, Human, C-Myc tag HG10452-CM
    Oncostatin M cDNA ORF Clone, Human, N-Myc tag HG10452-NM
    Oncostatin M qPCR Primer Pairs, Human HP100481
    info info
    添加购物车成功! 添加购物车失败!