Neurolysin cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50333-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Neurolysin Reagents

CRO Services

Product recommended


All Neurolysin Reagents

Neurolysin cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2115 bp
Description
Full length Clone DNA of Mouse neurolysin (metallopeptidase M3 family) with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Neurolysin cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

4930472G13Rik cDNA ORF Clone, Mouse;C79345 cDNA ORF Clone, Mouse

Neurolysin Background Information

Full Name
neurolysin (metallopeptidase M3 family)
Research Areas

Neurolysin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Neurolysin cDNA ORF Clone in Cloning Vector, Mouse MG50333-M
Neurolysin cDNA ORF Clone, Mouse, untagged MG50333-UT
Neurolysin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50333-ACG
Neurolysin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50333-ACGLN
Neurolysin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50333-ANG
Neurolysin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50333-ACR
Neurolysin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50333-ANR
Neurolysin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50333-CF
Neurolysin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50333-NF
Neurolysin cDNA ORF Clone, Mouse, C-His tag MG50333-CH
Neurolysin cDNA ORF Clone, Mouse, N-His tag MG50333-NH
Neurolysin cDNA ORF Clone, Mouse, C-HA tag MG50333-CY
Neurolysin cDNA ORF Clone, Mouse, N-HA tag MG50333-NY
Neurolysin cDNA ORF Clone, Mouse, N-Myc tag MG50333-NM
Neurolysin qPCR Primer Pairs, Mouse MP200356

Neurolysin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Neurolysin cDNA ORF Clone in Cloning Vector, Human HG10255-M
Neurolysin cDNA ORF Clone, Human, untagged HG10255-UT
Neurolysin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10255-ACGLN
Neurolysin cDNA ORF Clone, Human, C-GFPSpark® tag HG10255-ACG
Neurolysin cDNA ORF Clone, Human, N-GFPSpark® tag HG10255-ANG
Neurolysin cDNA ORF Clone, Human, C-OFPSpark® tag HG10255-ACR
Neurolysin cDNA ORF Clone, Human, N-OFPSpark® tag HG10255-ANR
Neurolysin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10255-CF
Neurolysin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10255-NF
Neurolysin cDNA ORF Clone, Human, C-His tag HG10255-CH
Neurolysin cDNA ORF Clone, Human, N-His tag HG10255-NH
Neurolysin cDNA ORF Clone, Human, C-HA tag HG10255-CY
Neurolysin cDNA ORF Clone, Human, N-HA tag HG10255-NY
Neurolysin cDNA ORF Clone, Human, C-Myc tag HG10255-CM
Neurolysin cDNA ORF Clone, Human, N-Myc tag HG10255-NM
Neurolysin qPCR Primer Pairs, Human HP100304
info info
添加购物车成功! 添加购物车失败!