NELFA/WHSC2 cDNA ORF Clone, Mouse, untagged

Cat: MG51363-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NELFA/WHSC2 Reagents
CRO Services
Product recommended

All NELFA/WHSC2 Reagents
NELFA/WHSC2 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1593 bp
Description
Full length Clone DNA of Mouse negative elongation factor complex member A, Whsc2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NELFA/WHSC2 cDNA ORF Clone, Mouse, untagged Alternative Names
Whsc2 cDNA ORF Clone, Mouse;Whsc2h cDNA ORF Clone, Mouse
NELFA/WHSC2 Background Information
Full Name
negative elongation factor complex member A

NELFA/WHSC2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NELFA/WHSC2 cDNA ORF Clone in Cloning Vector, Rat RG81274-U
NELFA/WHSC2 cDNA ORF Clone, Rat, untagged RG81274-UT
NELFA/WHSC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81274-ACGLN
NELFA/WHSC2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81274-ACG
NELFA/WHSC2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81274-ANG
NELFA/WHSC2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81274-ACR
NELFA/WHSC2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81274-ANR
NELFA/WHSC2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81274-CF
NELFA/WHSC2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81274-NF
NELFA/WHSC2 cDNA ORF Clone, Rat, C-His tag RG81274-CH
NELFA/WHSC2 cDNA ORF Clone, Rat, N-His tag RG81274-NH
NELFA/WHSC2 cDNA ORF Clone, Rat, C-HA tag RG81274-CY
NELFA/WHSC2 cDNA ORF Clone, Rat, N-HA tag RG81274-NY
NELFA/WHSC2 cDNA ORF Clone, Rat, C-Myc tag RG81274-CM
NELFA/WHSC2 cDNA ORF Clone, Rat, N-Myc tag RG81274-NM
NELFA/WHSC2 qPCR Primer Pairs, Rat RP301230

NELFA/WHSC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NELFA/WHSC2 cDNA ORF Clone in Cloning Vector, Mouse MG51363-U
NELFA/WHSC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51363-ACG
NELFA/WHSC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51363-ACGLN
NELFA/WHSC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51363-ANG
NELFA/WHSC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51363-ACR
NELFA/WHSC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51363-ANR
NELFA/WHSC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51363-CF
NELFA/WHSC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51363-NF
NELFA/WHSC2 cDNA ORF Clone, Mouse, C-His tag MG51363-CH
NELFA/WHSC2 cDNA ORF Clone, Mouse, N-His tag MG51363-NH
NELFA/WHSC2 cDNA ORF Clone, Mouse, C-HA tag MG51363-CY
NELFA/WHSC2 cDNA ORF Clone, Mouse, N-HA tag MG51363-NY
NELFA/WHSC2 cDNA ORF Clone, Mouse, C-Myc tag MG51363-CM
NELFA/WHSC2 cDNA ORF Clone, Mouse, N-Myc tag MG51363-NM
NELFA/WHSC2 qPCR Primer Pairs, Mouse MP201239
info info
添加购物车成功! 添加购物车失败!