NDRG2 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51971-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NDRG2 Reagents

CRO Services

Product recommended


All NDRG2 Reagents

NDRG2 cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1116 bp
Description
Full length Clone DNA of Mouse N-myc downstream regulated gene 2 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDRG2 cDNA ORF Clone, Mouse, N-His tag Alternative Names

AI182517 cDNA ORF Clone, Mouse;AU040374 cDNA ORF Clone, Mouse;Ndr2 cDNA ORF Clone, Mouse;SYLD cDNA ORF Clone, Mouse

NDRG2 Background Information

Full Name
NDRG family member 2

NDRG2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NDRG2 cDNA ORF Clone in Cloning Vector, Rat RG81132-U
NDRG2 cDNA ORF Clone, Rat, untagged RG81132-UT
NDRG2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81132-ACGLN
NDRG2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81132-ACG
NDRG2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81132-ANG
NDRG2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81132-ACR
NDRG2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81132-ANR
NDRG2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81132-CF
NDRG2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81132-NF
NDRG2 cDNA ORF Clone, Rat, C-His tag RG81132-CH
NDRG2 cDNA ORF Clone, Rat, N-His tag RG81132-NH
NDRG2 cDNA ORF Clone, Rat, C-HA tag RG81132-CY
NDRG2 cDNA ORF Clone, Rat, N-HA tag RG81132-NY
NDRG2 cDNA ORF Clone, Rat, C-Myc tag RG81132-CM
NDRG2 cDNA ORF Clone, Rat, N-Myc tag RG81132-NM
NDRG2 qPCR Primer Pairs, Rat RP301089

NDRG2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDRG2 cDNA ORF Clone in Cloning Vector, Mouse MG51971-U
NDRG2 cDNA ORF Clone, Mouse, untagged MG51971-UT
NDRG2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51971-ACG
NDRG2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51971-ACGLN
NDRG2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51971-ANG
NDRG2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51971-ACR
NDRG2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51971-ANR
NDRG2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51971-CF
NDRG2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51971-NF
NDRG2 cDNA ORF Clone, Mouse, C-His tag MG51971-CH
NDRG2 cDNA ORF Clone, Mouse, C-HA tag MG51971-CY
NDRG2 cDNA ORF Clone, Mouse, N-HA tag MG51971-NY
NDRG2 cDNA ORF Clone, Mouse, C-Myc tag MG51971-CM
NDRG2 cDNA ORF Clone, Mouse, N-Myc tag MG51971-NM
NDRG2 qPCR Primer Pairs, Mouse MP201844

NDRG2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDRG2 cDNA ORF Clone in Cloning Vector, Human HG14184-G
NDRG2 cDNA ORF Clone, Human, untagged HG14184-UT
NDRG2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14184-ACGLN
NDRG2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14184-ACG
NDRG2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14184-ANG
NDRG2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14184-ACR
NDRG2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14184-ANR
NDRG2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14184-CF
NDRG2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14184-NF
NDRG2 cDNA ORF Clone, Human, C-His tag HG14184-CH
NDRG2 cDNA ORF Clone, Human, N-His tag HG14184-NH
NDRG2 cDNA ORF Clone, Human, C-HA tag HG14184-G-Y
NDRG2 cDNA ORF Clone, Human, C-HA tag HG14184-CY
NDRG2 cDNA ORF Clone, Human, N-HA tag HG14184-NY
NDRG2 cDNA ORF Clone, Human, C-Myc tag HG14184-CM
NDRG2 cDNA ORF Clone, Human, N-Myc tag HG14184-NM
NDRG2 qPCR Primer Pairs, Human HP102835
info info
添加购物车成功! 添加购物车失败!