NCALD cDNA ORF Clone, Mouse, untagged

Cat: MG51340-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NCALD Reagents

CRO Services

Product recommended


All NCALD Reagents

NCALD cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
582 bp
Description
Full length Clone DNA of Mouse neurocalcin delta.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NCALD cDNA ORF Clone, Mouse, untagged Alternative Names

AI848120 cDNA ORF Clone, Mouse;D030020D09Rik cDNA ORF Clone, Mouse;D15Ertd412e cDNA ORF Clone, Mouse

NCALD Background Information

Full Name
neurocalcin delta

NCALD cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
NCALD cDNA ORF Clone in Cloning Vector, Rhesus CG90565-G
NCALD cDNA ORF Clone, Rhesus, untagged CG90565-UT
NCALD Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90565-ACGLN
NCALD cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90565-ACG
NCALD cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90565-ANG
NCALD cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90565-ACR
NCALD cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90565-ANR
NCALD cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90565-CF
NCALD cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90565-NF
NCALD cDNA ORF Clone, Rhesus, C-His tag CG90565-CH
NCALD cDNA ORF Clone, Rhesus, N-His tag CG90565-NH
NCALD cDNA ORF Clone, Rhesus, C-HA tag CG90565-CY
NCALD cDNA ORF Clone, Rhesus, N-HA tag CG90565-NY
NCALD cDNA ORF Clone, Rhesus, C-Myc tag CG90565-CM
NCALD cDNA ORF Clone, Rhesus, N-Myc tag CG90565-NM

NCALD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NCALD cDNA ORF Clone in Cloning Vector, Mouse MG51340-U
NCALD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51340-ACG
NCALD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51340-ACGLN
NCALD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51340-ANG
NCALD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51340-ACR
NCALD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51340-ANR
NCALD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51340-CF
NCALD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51340-NF
NCALD cDNA ORF Clone, Mouse, C-His tag MG51340-CH
NCALD cDNA ORF Clone, Mouse, N-His tag MG51340-NH
NCALD cDNA ORF Clone, Mouse, C-HA tag MG51340-CY
NCALD cDNA ORF Clone, Mouse, N-HA tag MG51340-NY
NCALD cDNA ORF Clone, Mouse, C-Myc tag MG51340-CM
NCALD cDNA ORF Clone, Mouse, N-Myc tag MG51340-NM
NCALD qPCR Primer Pairs, Mouse MP201217

NCALD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NCALD cDNA ORF Clone in Cloning Vector, Human HG15664-G
NCALD cDNA ORF Clone, Human, untagged HG15664-UT
NCALD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15664-ACGLN
NCALD cDNA ORF Clone, Human, C-GFPSpark® tag HG15664-ACG
NCALD cDNA ORF Clone, Human, N-GFPSpark® tag HG15664-ANG
NCALD cDNA ORF Clone, Human, C-OFPSpark® tag HG15664-ACR
NCALD cDNA ORF Clone, Human, N-OFPSpark® tag HG15664-ANR
NCALD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15664-CF
NCALD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15664-NF
NCALD cDNA ORF Clone, Human, C-His tag HG15664-CH
NCALD cDNA ORF Clone, Human, N-His tag HG15664-NH
NCALD cDNA ORF Clone, Human, C-HA tag HG15664-CY
NCALD cDNA ORF Clone, Human, N-HA tag HG15664-NY
NCALD cDNA ORF Clone, Human, C-Myc tag HG15664-CM
NCALD cDNA ORF Clone, Human, N-Myc tag HG15664-NM
NCALD qPCR Primer Pairs, Human HP104279
info info
添加购物车成功! 添加购物车失败!