MCM7 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51188-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MCM7 Reagents
CRO Services
Product recommended

All MCM7 Reagents
MCM7 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2160 bp
Description
Full length Clone DNA of Mouse minichromosome maintenance deficient 7 (S. cerevisiae) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MCM7 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AI747533 cDNA ORF Clone, Mouse;mCDC47 cDNA ORF Clone, Mouse;Mcmd7 cDNA ORF Clone, Mouse
MCM7 Background Information
Full Name
minichromosome maintenance complex component 7

MCM7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MCM7 cDNA ORF Clone in Cloning Vector, Rat RG80984-U
MCM7 cDNA ORF Clone, Rat, untagged RG80984-UT
MCM7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80984-ACGLN
MCM7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80984-ACG
MCM7 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80984-ANG
MCM7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80984-ACR
MCM7 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80984-ANR
MCM7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80984-CF
MCM7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80984-NF
MCM7 cDNA ORF Clone, Rat, C-His tag RG80984-CH
MCM7 cDNA ORF Clone, Rat, N-His tag RG80984-NH
MCM7 cDNA ORF Clone, Rat, C-HA tag RG80984-CY
MCM7 cDNA ORF Clone, Rat, N-HA tag RG80984-NY
MCM7 cDNA ORF Clone, Rat, C-Myc tag RG80984-CM
MCM7 cDNA ORF Clone, Rat, N-Myc tag RG80984-NM
MCM7 qPCR Primer Pairs, Rat RP300948

MCM7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MCM7 cDNA ORF Clone in Cloning Vector, Mouse MG51188-G
MCM7 cDNA ORF Clone, Mouse, untagged MG51188-UT
MCM7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51188-ACG
MCM7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51188-ACGLN
MCM7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51188-ANG
MCM7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51188-ACR
MCM7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51188-ANR
MCM7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51188-CF
MCM7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51188-NF
MCM7 cDNA ORF Clone, Mouse, C-His tag MG51188-CH
MCM7 cDNA ORF Clone, Mouse, N-His tag MG51188-NH
MCM7 cDNA ORF Clone, Mouse, N-HA tag MG51188-NY
MCM7 cDNA ORF Clone, Mouse, C-Myc tag MG51188-CM
MCM7 cDNA ORF Clone, Mouse, N-Myc tag MG51188-NM
MCM7 qPCR Primer Pairs, Mouse MP201072

MCM7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MCM7 cDNA ORF Clone in Cloning Vector, Human HG16465-G
MCM7 cDNA ORF Clone, Human, untagged HG16465-UT
MCM7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16465-ACGLN
MCM7 cDNA ORF Clone, Human, C-GFPSpark® tag HG16465-ACG
MCM7 cDNA ORF Clone, Human, N-GFPSpark® tag HG16465-ANG
MCM7 cDNA ORF Clone, Human, C-OFPSpark® tag HG16465-ACR
MCM7 cDNA ORF Clone, Human, N-OFPSpark® tag HG16465-ANR
MCM7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16465-CF
MCM7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16465-NF
MCM7 cDNA ORF Clone, Human, C-His tag HG16465-CH
MCM7 cDNA ORF Clone, Human, N-His tag HG16465-NH
MCM7 cDNA ORF Clone, Human, C-HA tag HG16465-CY
MCM7 cDNA ORF Clone, Human, N-HA tag HG16465-NY
MCM7 cDNA ORF Clone, Human, C-Myc tag HG16465-CM
MCM7 cDNA ORF Clone, Human, N-Myc tag HG16465-NM
MCM7 qPCR Primer Pairs, Human HP105210
info info
添加购物车成功! 添加购物车失败!