MAPK10/JNK3 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51077-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MAPK10/JNK3 Reagents
CRO Services
Product recommended

All MAPK10/JNK3 Reagents
MAPK10/JNK3 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1269 bp
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase 10 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAPK10/JNK3 cDNA ORF Clone, Mouse, C-His tag Alternative Names
C230008H04Rik cDNA ORF Clone, Mouse;JNK3 cDNA ORF Clone, Mouse;JNK3B1 cDNA ORF Clone, Mouse;JNK3B2 cDNA ORF Clone, Mouse;p493F12 cDNA ORF Clone, Mouse;p54bSAPK cDNA ORF Clone, Mouse;SAPK(beta) cDNA ORF Clone, Mouse;Serk2 cDNA ORF Clone, Mouse
MAPK10/JNK3 Background Information
Full Name
mitogen-activated protein kinase 10

MAPK10/JNK3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MAPK10/JNK3 cDNA ORF Clone in Cloning Vector, Mouse MG51077-G
MAPK10/JNK3 cDNA ORF Clone, Mouse, untagged MG51077-UT
MAPK10/JNK3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51077-ACG
MAPK10/JNK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51077-ACGLN
MAPK10/JNK3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51077-ANG
MAPK10/JNK3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51077-ACR
MAPK10/JNK3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51077-ANR
MAPK10/JNK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51077-CF
MAPK10/JNK3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51077-NF
MAPK10/JNK3 cDNA ORF Clone, Mouse, N-His tag MG51077-NH
MAPK10/JNK3 cDNA ORF Clone, Mouse, C-HA tag MG51077-CY
MAPK10/JNK3 cDNA ORF Clone, Mouse, N-HA tag MG51077-NY
MAPK10/JNK3 cDNA ORF Clone, Mouse, C-Myc tag MG51077-CM
MAPK10/JNK3 cDNA ORF Clone, Mouse, N-Myc tag MG51077-NM
MAPK10/JNK3 qPCR Primer Pairs, Mouse MP201035

MAPK10/JNK3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MAPK10/JNK3 cDNA ORF Clone in Cloning Vector, Human HG10626-M
MAPK10/JNK3 cDNA ORF Clone, Human, untagged HG10626-UT
MAPK10/JNK3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10626-ACGLN
MAPK10/JNK3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10626-ACG
MAPK10/JNK3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10626-ANG
MAPK10/JNK3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10626-ACR
MAPK10/JNK3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10626-ANR
MAPK10/JNK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10626-CF
MAPK10/JNK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10626-NF
MAPK10/JNK3 cDNA ORF Clone, Human, C-His tag HG10626-CH
MAPK10/JNK3 cDNA ORF Clone, Human, N-His tag HG10626-NH
MAPK10/JNK3 cDNA ORF Clone, Human, C-HA tag HG10626-CY
MAPK10/JNK3 cDNA ORF Clone, Human, N-HA tag HG10626-NY
MAPK10/JNK3 cDNA ORF Clone, Human, C-Myc tag HG10626-CM
MAPK10/JNK3 cDNA ORF Clone, Human, N-Myc tag HG10626-NM
MAPK10/JNK3 qPCR Primer Pairs, Human HP100866
info info
添加购物车成功! 添加购物车失败!