LYPD3 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50546-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LYPD3 Reagents
CRO Services
Product recommended

All LYPD3 Reagents
LYPD3 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1092 bp
Description
Full length Clone DNA of Mouse Ly6/Plaur domain containing 3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LYPD3 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
2310061G07Rik cDNA ORF Clone, Mouse;C4.4a cDNA ORF Clone, Mouse
LYPD3 Background Information

Ly6 / PLAUR domain-containing protein 3, also known as GPI-anchored metastasis-associated protein C4.4A homolog, Matrigel-induced gene C4 protein, MIG-C4 and LYPD3, is a cell membrane protein which contains two UPAR/Ly6 domains. Human LYPD3 contains two UPAR/Ly6 domains. LYPD3 is expressed in placenta, skin and urothelium. It is found in suprabasal keratinocytes of chronic wounds. Weak expression of LYPD3 is found in esophagus and peripheral blood mononuclear cells. It is found in the majority of primary and metastatic transitional cell carcinomas (TCCs) and as well in breast cancer tissues, but not in adjacent normal tissues. High expression of LYPD3 is found in the tumor component of some noninvasive superficial lesions and in invasive and metastatic urothelial cancers. LYPD3 is up-regulated in migrating keratinocytes during epithelisation of incisional skin wounds. LYPD3 supports cell migration. It may be involved in urothelial cell-matrix interactions. It may also be involved in tumor progression

Full Name
LY6/PLAUR domain containing 3
Research Areas
References
  • Smith B.A., et al., 2001, Cancer Res. 61:1678-85.
  • Wuerfel J., et al., 2001, Gene 262:35-41.
  • Clark H.F., et al., 2003, Genome Res. 13:2265-70.
  • Fletcher G.C., et al., 2003, Br. J. Cancer 88:579-85.
  • Hansen L.V., et al., 2004, Biochem. Eng. J. 380:845-57.
  • LYPD3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LYPD3 cDNA ORF Clone in Cloning Vector, Mouse MG50546-M
    LYPD3 cDNA ORF Clone, Mouse, untagged MG50546-UT
    LYPD3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50546-ACGLN
    LYPD3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50546-ACG
    LYPD3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50546-ACR
    LYPD3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50546-CF
    LYPD3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50546-NF
    LYPD3 cDNA ORF Clone, Mouse, C-His tag MG50546-CH
    LYPD3 cDNA ORF Clone, Mouse, N-His tag MG50546-NH
    LYPD3 cDNA ORF Clone, Mouse, C-HA tag MG50546-CY
    LYPD3 cDNA ORF Clone, Mouse, C-Myc tag MG50546-CM
    LYPD3 cDNA ORF Clone, Mouse, N-Myc tag MG50546-NM
    LYPD3 qPCR Primer Pairs, Mouse MP200538

    LYPD3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LYPD3 cDNA ORF Clone in Cloning Vector, Human HG11836-G
    LYPD3 cDNA ORF Clone, Human, untagged HG11836-UT
    LYPD3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11836-ACGLN
    LYPD3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11836-ACG
    LYPD3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11836-ACR
    LYPD3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11836-CF
    LYPD3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11836-NF
    LYPD3 cDNA ORF Clone, Human, C-His tag HG11836-CH
    LYPD3 cDNA ORF Clone, Human, N-His tag HG11836-NH
    LYPD3 cDNA ORF Clone, Human, C-HA tag HG11836-CY
    LYPD3 cDNA ORF Clone, Human, N-HA tag HG11836-NY
    LYPD3 cDNA ORF Clone, Human, C-Myc tag HG11836-CM
    LYPD3 cDNA ORF Clone, Human, N-Myc tag HG11836-NM
    LYPD3 qPCR Primer Pairs, Human HP104581
    info info
    添加购物车成功! 添加购物车失败!