Galectin-3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50406-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Galectin-3 Reagents

CRO Services

Product recommended


All Galectin-3 Reagents

Galectin-3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
834 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 117T/C,132C/T,141A/G,186C/T,546G/A,627C/A not causing the amino acid variation.
Description
Full length Clone DNA of Mouse lectin, galactose binding, soluble 3 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI(6kb+0.83kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Galectin-3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Galectin-3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images

Cynomolgus CDCP1 Gene Plasmid Map 5627

Galectin-3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

gal3 cDNA ORF Clone, Mouse;GBP cDNA ORF Clone, Mouse;L-34 cDNA ORF Clone, Mouse;Mac-2 cDNA ORF Clone, Mouse

Galectin-3 Background Information

Full Name
lectin, galactoside-binding, soluble, 3
References
  • Dumic J, et al. (2006) Galectin-3: an open-ended story. Biochim Biophys Acta. 1760(4): 616-35.
  • Sharma UC, et al. (2004) Galectin-3 marks activated macrophages in failure-prone hypertrophied hearts and contributes to cardiac dysfunction. Circulation. 110(19): 3121-8.
  • Yan YP, et al. (2009) Galectin-3 mediates post-ischemic tissue remodeling. Brain Res. 1288: 116-24.
  • Galectin-3 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Galectin-3 cDNA ORF Clone in Cloning Vector, Rhesus CG90166-G
    Galectin-3 cDNA ORF Clone, Rhesus, untagged CG90166-UT
    Galectin-3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90166-ACGLN
    Galectin-3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90166-ACG
    Galectin-3 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90166-ANG
    Galectin-3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90166-ACR
    Galectin-3 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90166-ANR
    Galectin-3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90166-CF
    Galectin-3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90166-NF
    Galectin-3 cDNA ORF Clone, Rhesus, C-His tag CG90166-CH
    Galectin-3 cDNA ORF Clone, Rhesus, N-His tag CG90166-NH
    Galectin-3 cDNA ORF Clone, Rhesus, C-HA tag CG90166-CY
    Galectin-3 cDNA ORF Clone, Rhesus, N-HA tag CG90166-NY
    Galectin-3 cDNA ORF Clone, Rhesus, C-Myc tag CG90166-CM
    Galectin-3 cDNA ORF Clone, Rhesus, N-Myc tag CG90166-NM

    Galectin-3 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Galectin-3 cDNA ORF Clone in Cloning Vector, Rat RG80393-G
    Galectin-3 cDNA ORF Clone, Rat, untagged RG80393-UT
    Galectin-3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80393-ACGLN
    Galectin-3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80393-ACG
    Galectin-3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80393-ANG
    Galectin-3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80393-ACR
    Galectin-3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80393-ANR
    Galectin-3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80393-CF
    Galectin-3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80393-NF
    Galectin-3 cDNA ORF Clone, Rat, C-His tag RG80393-CH
    Galectin-3 cDNA ORF Clone, Rat, N-His tag RG80393-NH
    Galectin-3 cDNA ORF Clone, Rat, C-HA tag RG80393-CY
    Galectin-3 cDNA ORF Clone, Rat, N-HA tag RG80393-NY
    Galectin-3 cDNA ORF Clone, Rat, C-Myc tag RG80393-CM
    Galectin-3 cDNA ORF Clone, Rat, N-Myc tag RG80393-NM
    Galectin-3 qPCR Primer Pairs, Rat RP300359

    Galectin-3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Galectin-3 cDNA ORF Clone in Cloning Vector, Mouse MG50406-M
    Galectin-3 cDNA ORF Clone, Mouse, untagged MG50406-UT
    Galectin-3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50406-ACGLN
    Galectin-3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50406-ACG
    Galectin-3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50406-ANG
    Galectin-3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50406-ACR
    Galectin-3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50406-ANR
    Galectin-3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50406-NF
    Galectin-3 cDNA ORF Clone, Mouse, C-His tag MG50406-CH
    Galectin-3 cDNA ORF Clone, Mouse, N-His tag MG50406-NH
    Galectin-3 cDNA ORF Clone, Mouse, C-HA tag MG50406-CY
    Galectin-3 cDNA ORF Clone, Mouse, N-HA tag MG50406-NY
    Galectin-3 cDNA ORF Clone, Mouse, C-Myc tag MG50406-CM
    Galectin-3 cDNA ORF Clone, Mouse, N-Myc tag MG50406-NM
    Galectin-3 qPCR Primer Pairs, Mouse MP200423

    Galectin-3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Galectin-3 cDNA ORF Clone in Cloning Vector, Human HG10289-G
    Galectin-3 cDNA ORF Clone, Human, untagged HG10289-UT
    Galectin-3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10289-ACGLN
    Galectin-3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10289-ACG
    Galectin-3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10289-ANG
    Galectin-3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10289-ACR
    Galectin-3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10289-ANR
    Galectin-3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10289-CF
    Galectin-3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10289-NF
    Galectin-3 cDNA ORF Clone, Human, C-His tag HG10289-CH
    Galectin-3 cDNA ORF Clone, Human, N-His tag HG10289-NH
    Galectin-3 cDNA ORF Clone, Human, C-HA tag HG10289-CY
    Galectin-3 cDNA ORF Clone, Human, N-HA tag HG10289-NY
    Galectin-3 cDNA ORF Clone, Human, C-Myc tag HG10289-CM
    Galectin-3 cDNA ORF Clone, Human, N-Myc tag HG10289-NM
    Galectin-3 qPCR Primer Pairs, Human HP100334
    info info
    添加购物车成功! 添加购物车失败!