IVD cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

IVD cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Mouse isovaleryl coenzyme A dehydrogenase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IVD cDNA ORF Clone, Mouse, N-His tag: Alternative Names

1300016K07Rik cDNA ORF Clone, Mouse; 6720455E18Rik cDNA ORF Clone, Mouse; AI463340 cDNA ORF Clone, Mouse

IVD Background Information

Isovaleryl-CoA dehydrogenase, also known as IVD, plays an essential role in processing proteins obtained from the diet. The body breaks down proteins from food into smaller parts called amino acids. Amino acids can be further processed to provide energy for growth and development. Isovaleryl-CoA dehydrogenase helps process a particular amino acid called leucine. Specifically, isovaleryl-CoA dehydrogenase is responsible for the third step in the breakdown of leucine. This step is a chemical reaction that converts a molecule called isovaleryl-CoA to another molecule, 3-methylcrotonyl-CoA. Additional chemical reactions convert 3-methylcrotonyl-CoA into molecules that are used for energy.
Full Name
isovaleryl-CoA dehydrogenase
References
  • BACHHAWAT BK, et al. (1956) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
  • Ikeda Y, et al. (1983) Purification and characterization of isovaleryl coenzyme A dehydrogenase from rat liver mitochondria. J Biol Chem. 258(2):1077-85.
  • Tanaka K, et al. (1966) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait