ISCA1/HBLD2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51637-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ISCA1/HBLD2 Reagents
CRO Services
Product recommended

All ISCA1/HBLD2 Reagents
ISCA1/HBLD2 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
390 bp
Description
Full length Clone DNA of Mouse iron-sulfur cluster assembly 1 homolog (S. cerevisiae) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ISCA1/HBLD2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
1810010A06Rik cDNA ORF Clone, Mouse;Hbld2 cDNA ORF Clone, Mouse
ISCA1/HBLD2 Background Information
Full Name
iron-sulfur cluster assembly 1

ISCA1/HBLD2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ISCA1/HBLD2 cDNA ORF Clone in Cloning Vector, Rat RG85552-U
ISCA1/HBLD2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85552-ACGLN

ISCA1/HBLD2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ISCA1/HBLD2 cDNA ORF Clone in Cloning Vector, Mouse MG51637-U
ISCA1/HBLD2 cDNA ORF Clone, Mouse, untagged MG51637-UT
ISCA1/HBLD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51637-ACGLN
ISCA1/HBLD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51637-ACG
ISCA1/HBLD2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51637-ANG
ISCA1/HBLD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51637-ACR
ISCA1/HBLD2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51637-ANR
ISCA1/HBLD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51637-CF
ISCA1/HBLD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51637-NF
ISCA1/HBLD2 cDNA ORF Clone, Mouse, C-His tag MG51637-CH
ISCA1/HBLD2 cDNA ORF Clone, Mouse, N-His tag MG51637-NH
ISCA1/HBLD2 cDNA ORF Clone, Mouse, C-HA tag MG51637-CY
ISCA1/HBLD2 cDNA ORF Clone, Mouse, N-HA tag MG51637-NY
ISCA1/HBLD2 cDNA ORF Clone, Mouse, N-Myc tag MG51637-NM
ISCA1/HBLD2 qPCR Primer Pairs, Mouse MP201510

ISCA1/HBLD2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ISCA1/HBLD2 cDNA ORF Clone in Cloning Vector, Human HG17000-U
ISCA1/HBLD2 cDNA ORF Clone, Human, untagged HG17000-UT
ISCA1/HBLD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG17000-ACG
ISCA1/HBLD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17000-ACGLN
ISCA1/HBLD2 cDNA ORF Clone, Human, N-GFPSpark® tag HG17000-ANG
ISCA1/HBLD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG17000-ACR
ISCA1/HBLD2 cDNA ORF Clone, Human, N-OFPSpark® tag HG17000-ANR
ISCA1/HBLD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17000-CF
ISCA1/HBLD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17000-NF
ISCA1/HBLD2 cDNA ORF Clone, Human, C-His tag HG17000-CH
ISCA1/HBLD2 cDNA ORF Clone, Human, N-His tag HG17000-NH
ISCA1/HBLD2 cDNA ORF Clone, Human, C-HA tag HG17000-CY
ISCA1/HBLD2 cDNA ORF Clone, Human, N-HA tag HG17000-NY
ISCA1/HBLD2 cDNA ORF Clone, Human, C-Myc tag HG17000-CM
ISCA1/HBLD2 cDNA ORF Clone, Human, N-Myc tag HG17000-NM
info info
添加购物车成功! 添加购物车失败!