IL-23 P19 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51086-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-23 P19 Reagents
CRO Services
Product recommended

All IL-23 P19 Reagents
IL-23 P19 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
591 bp
Description
Full length Clone DNA of Mouse interleukin 23, alpha subunit p19 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-23 P19 cDNA ORF Clone, Mouse, C-His tag Alternative Names
IL-23 cDNA ORF Clone, Mouse;p19 cDNA ORF Clone, Mouse
IL-23 P19 Background Information

IL-23, which is mainly secreted by antigen-presenting cells, is a member of the IL-12 family, which includes IL-12, IL-27, and IL-35[10]. IL-23 is a heterodimeric cytokine, comprised a unique p19 subunit and p40 subunit, the latter of which is shared with IL-12. The receptor for IL-23 consists of IL-23R and IL-12Rβ1, the latter of which is also characteristic of IL-12. IL-23 is essential for Th17 differentiation, expansion, and survival by binding to its receptor, thereby activating the signaling pathway [11,12]. Many studies revealed that the IL-23/Th17 pathway is implicated in the pathophysiology of various autoimmune diseases, such as autoimmune arthritis[13], primary biliary cirrhosis[14], and inflammatory bowel disease[15].

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interleukin 23, alpha subunit p19
References
  • Ye X, Zhang L, Wang H, et al. The Role of IL-23/Th17 Pathway in Patients with Primary Immune Thrombocytopenia. Kuwana M, ed. PLoS ONE. 2015;10(1):e0117704.
  • IL-23 P19 cDNA ORF Clone, Marmoset, Related Products

    Product Name Catalog#(PDF)
    IL-23 P19 cDNA ORF Clone in Cloning Vector, Marmoset CG90288-G
    IL-23 P19 cDNA ORF Clone, Marmoset, untagged CG90288-UT
    IL-23 P19 cDNA ORF Clone, Marmoset, C-GFPSpark® tag CG90288-ACG
    IL-23 P19 Lentiviral cDNA ORF Clone, Marmoset, C-GFPSpark® tag CG90288-ACGLN
    IL-23 P19 cDNA ORF Clone, Marmoset, C-OFPSpark® tag CG90288-ACR
    IL-23 P19 cDNA ORF Clone, Marmoset, C-DDK (Flag®) tag CG90288-CF
    IL-23 P19 cDNA ORF Clone, Marmoset, N-DDK (Flag®) tag CG90288-NF
    IL-23 P19 cDNA ORF Clone, Marmoset, C-His tag CG90288-CH
    IL-23 P19 cDNA ORF Clone, Marmoset, N-His tag CG90288-NH
    IL-23 P19 cDNA ORF Clone, Marmoset, C-HA tag CG90288-CY
    IL-23 P19 cDNA ORF Clone, Marmoset, N-HA tag CG90288-NY
    IL-23 P19 cDNA ORF Clone, Marmoset, C-Myc tag CG90288-CM
    IL-23 P19 cDNA ORF Clone, Marmoset, N-Myc tag CG90288-NM

    IL-23 P19 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL-23 P19 cDNA ORF Clone in Cloning Vector, Canine DG70103-G

    IL-23 P19 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-23 P19 cDNA ORF Clone in Cloning Vector, Rat RG80080-M
    IL-23 P19 cDNA ORF Clone, Rat, untagged RG80080-UT
    IL-23 P19 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80080-ACG
    IL-23 P19 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80080-ACGLN
    IL-23 P19 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80080-ACR
    IL-23 P19 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80080-CF
    IL-23 P19 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80080-NF
    IL-23 P19 cDNA ORF Clone, Rat, C-His tag RG80080-CH
    IL-23 P19 cDNA ORF Clone, Rat, N-His tag RG80080-NH
    IL-23 P19 cDNA ORF Clone, Rat, C-HA tag RG80080-CY
    IL-23 P19 cDNA ORF Clone, Rat, N-HA tag RG80080-NY
    IL-23 P19 cDNA ORF Clone, Rat, C-Myc tag RG80080-CM
    IL-23 P19 cDNA ORF Clone, Rat, N-Myc tag RG80080-NM
    IL-23 P19 qPCR Primer Pairs, Rat RP300076

    IL-23 P19 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-23 P19 cDNA ORF Clone in Cloning Vector, Mouse MG51086-G
    IL-23 P19 cDNA ORF Clone, Mouse, untagged MG51086-UT
    IL-23 P19 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51086-ACG
    IL-23 P19 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51086-ACGLN
    IL-23 P19 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51086-ACR
    IL-23 P19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51086-CF
    IL-23 P19 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51086-NF
    IL-23 P19 cDNA ORF Clone, Mouse, N-His tag MG51086-NH
    IL-23 P19 cDNA ORF Clone, Mouse, C-HA tag MG51086-CY
    IL-23 P19 cDNA ORF Clone, Mouse, N-HA tag MG51086-NY
    IL-23 P19 cDNA ORF Clone, Mouse, C-Myc tag MG51086-CM
    IL-23 P19 cDNA ORF Clone, Mouse, N-Myc tag MG51086-NM
    IL-23 P19 qPCR Primer Pairs, Mouse MP201044

    IL-23 P19 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-23 P19 cDNA ORF Clone, Human, untagged HG13062-UT
    IL-23 P19 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13062-ACGLN
    IL-23 P19 cDNA ORF Clone, Human, C-GFPSpark® tag HG13062-ACG
    IL-23 P19 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13062-CF
    IL-23 P19 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13062-NF
    IL-23 P19 cDNA ORF Clone, Human, C-His tag HG13062-CH
    IL-23 P19 cDNA ORF Clone, Human, C-HA tag HG13062-CY
    IL-23 P19 cDNA ORF Clone, Human, C-Myc tag HG13062-CM
    IL-23 P19 qPCR Primer Pairs, Human HP104636
    info info
    添加购物车成功! 添加购物车失败!