GTF2H1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52215-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GTF2H1 Reagents
CRO Services
Product recommended

All GTF2H1 Reagents
GTF2H1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1644 bp
Description
Full length Clone DNA of Mouse general transcription factor II H, polypeptide 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GTF2H1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
62kDa cDNA ORF Clone, Mouse;AW743425 cDNA ORF Clone, Mouse;AW822074 cDNA ORF Clone, Mouse;BTF2p62 cDNA ORF Clone, Mouse;C77871 cDNA ORF Clone, Mouse;p62 cDNA ORF Clone, Mouse
GTF2H1 Background Information
Full Name
general transcription factor IIH, polypeptide 1, 62kDa

GTF2H1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GTF2H1 cDNA ORF Clone in Cloning Vector, Mouse MG52215-U
GTF2H1 cDNA ORF Clone, Mouse, untagged MG52215-UT
GTF2H1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52215-ACGLN
GTF2H1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52215-ACG
GTF2H1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52215-ANG
GTF2H1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52215-ACR
GTF2H1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52215-ANR
GTF2H1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52215-NF
GTF2H1 cDNA ORF Clone, Mouse, C-His tag MG52215-CH
GTF2H1 cDNA ORF Clone, Mouse, N-His tag MG52215-NH
GTF2H1 cDNA ORF Clone, Mouse, C-HA tag MG52215-CY
GTF2H1 cDNA ORF Clone, Mouse, N-HA tag MG52215-NY
GTF2H1 cDNA ORF Clone, Mouse, C-Myc tag MG52215-CM
GTF2H1 cDNA ORF Clone, Mouse, N-Myc tag MG52215-NM
GTF2H1 qPCR Primer Pairs, Mouse MP202088

GTF2H1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GTF2H1 cDNA ORF Clone in Cloning Vector, Human HG16587-G
GTF2H1 cDNA ORF Clone, Human, untagged HG16587-UT
GTF2H1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16587-ACG
GTF2H1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16587-ACGLN
GTF2H1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16587-ANG
GTF2H1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16587-ACR
GTF2H1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16587-ANR
GTF2H1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16587-CF
GTF2H1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16587-NF
GTF2H1 cDNA ORF Clone, Human, C-His tag HG16587-CH
GTF2H1 cDNA ORF Clone, Human, N-His tag HG16587-NH
GTF2H1 cDNA ORF Clone, Human, C-HA tag HG16587-CY
GTF2H1 cDNA ORF Clone, Human, N-HA tag HG16587-NY
GTF2H1 cDNA ORF Clone, Human, C-Myc tag HG16587-CM
GTF2H1 cDNA ORF Clone, Human, N-Myc tag HG16587-NM
info info
添加购物车成功! 添加购物车失败!