FXYD6 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51635-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FXYD6 Reagents
CRO Services
Product recommended

All FXYD6 Reagents
FXYD6 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
282 bp
Description
Full length Clone DNA of Mouse FXYD domain-containing ion transport regulator 6 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FXYD6 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
0610030I18Rik cDNA ORF Clone, Mouse;Php cDNA ORF Clone, Mouse
FXYD6 Background Information
Full Name
FXYD domain containing ion transport regulator 6

FXYD6 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
FXYD6 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90544-G
FXYD6 cDNA ORF Clone, Cynomolgus, untagged CG90544-UT
FXYD6 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90544-ACGLN
FXYD6 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90544-ACG
FXYD6 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90544-ACR
FXYD6 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90544-CF
FXYD6 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90544-NF
FXYD6 cDNA ORF Clone, Cynomolgus, C-His tag CG90544-CH
FXYD6 cDNA ORF Clone, Cynomolgus, N-His tag CG90544-NH
FXYD6 cDNA ORF Clone, Cynomolgus, C-HA tag CG90544-CY
FXYD6 cDNA ORF Clone, Cynomolgus, N-HA tag CG90544-NY
FXYD6 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90544-CM
FXYD6 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90544-NM

FXYD6 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
FXYD6 cDNA ORF Clone in Cloning Vector, Canine DG70246-U
FXYD6 cDNA ORF Clone, Canine, untagged DG70246-UT
FXYD6 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70246-ACGLN
FXYD6 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70246-ACG
FXYD6 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70246-ACR
FXYD6 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70246-CF
FXYD6 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70246-NF
FXYD6 cDNA ORF Clone, Canine, C-His tag DG70246-CH
FXYD6 cDNA ORF Clone, Canine, N-His tag DG70246-NH
FXYD6 cDNA ORF Clone, Canine, C-HA tag DG70246-CY
FXYD6 cDNA ORF Clone, Canine, N-HA tag DG70246-NY
FXYD6 cDNA ORF Clone, Canine, C-Myc tag DG70246-CM
FXYD6 cDNA ORF Clone, Canine, N-Myc tag DG70246-NM

FXYD6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FXYD6 cDNA ORF Clone in Cloning Vector, Mouse MG51635-G
FXYD6 cDNA ORF Clone, Mouse, untagged MG51635-UT
FXYD6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51635-ACG
FXYD6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51635-ACGLN
FXYD6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51635-ACR
FXYD6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51635-CF
FXYD6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51635-NF
FXYD6 cDNA ORF Clone, Mouse, C-His tag MG51635-CH
FXYD6 cDNA ORF Clone, Mouse, N-His tag MG51635-NH
FXYD6 cDNA ORF Clone, Mouse, C-HA tag MG51635-CY
FXYD6 cDNA ORF Clone, Mouse, N-HA tag MG51635-NY
FXYD6 cDNA ORF Clone, Mouse, N-Myc tag MG51635-NM
FXYD6 qPCR Primer Pairs, Mouse MP201508

FXYD6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FXYD6 cDNA ORF Clone in Cloning Vector, Human HG21045-U
FXYD6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21045-ACGLN
info info
添加购物车成功! 添加购物车失败!