FXYD5/Dysadherin cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52773-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FXYD5/Dysadherin Reagents
CRO Services
Product recommended

All FXYD5/Dysadherin Reagents
FXYD5/Dysadherin cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
537 bp
Description
Full length Clone DNA of Mouse FXYD domain-containing ion transport regulator 5 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FXYD5/Dysadherin cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
EF-8 cDNA ORF Clone, Mouse;Oit2 cDNA ORF Clone, Mouse;RIC cDNA ORF Clone, Mouse
FXYD5/Dysadherin Background Information
Full Name
FXYD domain containing ion transport regulator 5

FXYD5/Dysadherin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FXYD5/Dysadherin cDNA ORF Clone in Cloning Vector, Mouse MG52773-G
FXYD5/Dysadherin cDNA ORF Clone, Mouse, untagged MG52773-UT
FXYD5/Dysadherin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52773-ACG
FXYD5/Dysadherin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52773-ACGLN
FXYD5/Dysadherin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52773-ANG
FXYD5/Dysadherin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52773-ACR
FXYD5/Dysadherin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52773-ANR
FXYD5/Dysadherin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52773-CF
FXYD5/Dysadherin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52773-NF
FXYD5/Dysadherin cDNA ORF Clone, Mouse, C-His tag MG52773-CH
FXYD5/Dysadherin cDNA ORF Clone, Mouse, N-His tag MG52773-NH
FXYD5/Dysadherin cDNA ORF Clone, Mouse, C-HA tag MG52773-CY
FXYD5/Dysadherin cDNA ORF Clone, Mouse, N-HA tag MG52773-NY
FXYD5/Dysadherin cDNA ORF Clone, Mouse, N-Myc tag MG52773-NM

FXYD5/Dysadherin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FXYD5/Dysadherin cDNA ORF Clone in Cloning Vector, Human HG13454-G
FXYD5/Dysadherin cDNA ORF Clone, Human, untagged HG13454-UT
FXYD5/Dysadherin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13454-ACGLN
FXYD5/Dysadherin cDNA ORF Clone, Human, C-GFPSpark® tag HG13454-ACG
FXYD5/Dysadherin cDNA ORF Clone, Human, C-OFPSpark® tag HG13454-ACR
FXYD5/Dysadherin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13454-CF
FXYD5/Dysadherin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13454-NF
FXYD5/Dysadherin cDNA ORF Clone, Human, C-His tag HG13454-CH
FXYD5/Dysadherin cDNA ORF Clone, Human, N-His tag HG13454-NH
FXYD5/Dysadherin cDNA ORF Clone, Human, C-HA tag HG13454-CY
FXYD5/Dysadherin cDNA ORF Clone, Human, N-HA tag HG13454-NY
FXYD5/Dysadherin cDNA ORF Clone, Human, C-Myc tag HG13454-CM
FXYD5/Dysadherin cDNA ORF Clone, Human, N-Myc tag HG13454-NM
FXYD5/Dysadherin qPCR Primer Pairs, Human HP102154
info info
添加购物车成功! 添加购物车失败!