Dynein intermediate chain 1 cDNA ORF Clone, Mouse, untagged

Cat: MG51372-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Dynein intermediate chain 1 Reagents
CRO Services
Product recommended

All Dynein intermediate chain 1 Reagents
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1887 bp
Description
Full length Clone DNA of Mouse dynein cytoplasmic 1 intermediate chain 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Dynein intermediate chain 1 cDNA ORF Clone, Mouse, untagged Alternative Names
DHIC-1 cDNA ORF Clone, Mouse;DIC cDNA ORF Clone, Mouse;Dncic1 cDNA ORF Clone, Mouse;IC74 cDNA ORF Clone, Mouse
Dynein intermediate chain 1 Background Information
Full Name
dynein, cytoplasmic 1, intermediate chain 1

Dynein intermediate chain 1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Dynein intermediate chain 1 cDNA ORF Clone in Cloning Vector, Rat RG84432-U
Dynein intermediate chain 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84432-ACGLN

Dynein intermediate chain 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Dynein intermediate chain 1 cDNA ORF Clone in Cloning Vector, Mouse MG51372-U
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51372-ACG
Dynein intermediate chain 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51372-ACGLN
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51372-ANG
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51372-ACR
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51372-ANR
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51372-CF
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51372-NF
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, C-His tag MG51372-CH
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, N-His tag MG51372-NH
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, C-HA tag MG51372-CY
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, N-HA tag MG51372-NY
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, C-Myc tag MG51372-CM
Dynein intermediate chain 1 cDNA ORF Clone, Mouse, N-Myc tag MG51372-NM
Dynein intermediate chain 1 qPCR Primer Pairs, Mouse MP201245

Dynein intermediate chain 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Dynein intermediate chain 1 cDNA ORF Clone in Cloning Vector, Human HG15041-G
Dynein intermediate chain 1 cDNA ORF Clone, Human, untagged HG15041-UT
Dynein intermediate chain 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15041-ACGLN
Dynein intermediate chain 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15041-ACG
Dynein intermediate chain 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15041-ANG
Dynein intermediate chain 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15041-ACR
Dynein intermediate chain 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15041-ANR
Dynein intermediate chain 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15041-CF
Dynein intermediate chain 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15041-NF
Dynein intermediate chain 1 cDNA ORF Clone, Human, C-His tag HG15041-CH
Dynein intermediate chain 1 cDNA ORF Clone, Human, N-His tag HG15041-NH
Dynein intermediate chain 1 cDNA ORF Clone, Human, C-HA tag HG15041-CY
Dynein intermediate chain 1 cDNA ORF Clone, Human, N-HA tag HG15041-NY
Dynein intermediate chain 1 cDNA ORF Clone, Human, C-Myc tag HG15041-CM
Dynein intermediate chain 1 cDNA ORF Clone, Human, N-Myc tag HG15041-NM
Dynein intermediate chain 1 qPCR Primer Pairs, Human HP103669
info info
添加购物车成功! 添加购物车失败!