dermatopontin cDNA ORF Clone, Mouse, untagged

Cat: MG50270-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All dermatopontin Reagents

CRO Services

Product recommended


All dermatopontin Reagents

dermatopontin cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
606 bp
Description
Full length Clone DNA of Mouse dermatopontin.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

dermatopontin cDNA ORF Clone, Mouse, untagged Alternative Names

1810032B19Rik cDNA ORF Clone, Mouse;5033416F05Rik cDNA ORF Clone, Mouse;EQ-1 cDNA ORF Clone, Mouse;Eq1 cDNA ORF Clone, Mouse

dermatopontin Background Information

Full Name
dermatopontin

dermatopontin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
dermatopontin cDNA ORF Clone in Cloning Vector, Rat RG81222-U
dermatopontin cDNA ORF Clone, Rat, untagged RG81222-UT
dermatopontin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81222-ACG
dermatopontin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81222-ACGLN
dermatopontin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81222-ACR
dermatopontin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81222-CF
dermatopontin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81222-NF
dermatopontin cDNA ORF Clone, Rat, C-His tag RG81222-CH
dermatopontin cDNA ORF Clone, Rat, N-His tag RG81222-NH
dermatopontin cDNA ORF Clone, Rat, C-HA tag RG81222-CY
dermatopontin cDNA ORF Clone, Rat, N-HA tag RG81222-NY
dermatopontin cDNA ORF Clone, Rat, C-Myc tag RG81222-CM
dermatopontin cDNA ORF Clone, Rat, N-Myc tag RG81222-NM
dermatopontin qPCR Primer Pairs, Rat RP301178

dermatopontin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
dermatopontin cDNA ORF Clone in Cloning Vector, Mouse MG50270-M
dermatopontin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50270-ACGLN
dermatopontin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50270-ACG
dermatopontin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50270-ACR
dermatopontin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50270-CF
dermatopontin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50270-NF
dermatopontin cDNA ORF Clone, Mouse, C-His tag MG50270-CH
dermatopontin cDNA ORF Clone, Mouse, N-His tag MG50270-NH
dermatopontin cDNA ORF Clone, Mouse, C-HA tag MG50270-CY
dermatopontin cDNA ORF Clone, Mouse, N-HA tag MG50270-NY
dermatopontin cDNA ORF Clone, Mouse, C-Myc tag MG50270-CM
dermatopontin cDNA ORF Clone, Mouse, N-Myc tag MG50270-NM
dermatopontin qPCR Primer Pairs, Mouse MP200295

dermatopontin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
dermatopontin cDNA ORF Clone in Cloning Vector, Human HG12263-G
dermatopontin cDNA ORF Clone, Human, untagged HG12263-UT
dermatopontin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12263-ACGLN
dermatopontin cDNA ORF Clone, Human, C-GFPSpark® tag HG12263-ACG
dermatopontin cDNA ORF Clone, Human, C-OFPSpark® tag HG12263-ACR
dermatopontin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12263-CF
dermatopontin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12263-NF
dermatopontin cDNA ORF Clone, Human, C-His tag HG12263-CH
dermatopontin cDNA ORF Clone, Human, N-His tag HG12263-NH
dermatopontin cDNA ORF Clone, Human, C-HA tag HG12263-CY
dermatopontin cDNA ORF Clone, Human, N-HA tag HG12263-NY
dermatopontin cDNA ORF Clone, Human, C-Myc tag HG12263-CM
dermatopontin cDNA ORF Clone, Human, N-Myc tag HG12263-NM
dermatopontin qPCR Primer Pairs, Human HP101876
info info
添加购物车成功! 添加购物车失败!