DPP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51019-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DPP2 Reagents

CRO Services

Product recommended


All DPP2 Reagents

DPP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1521 bp
Description
Full length Clone DNA of Mouse dipeptidylpeptidase 7 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DPP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

Dpp2 cDNA ORF Clone, Mouse;DPPII cDNA ORF Clone, Mouse;QPP cDNA ORF Clone, Mouse

DPP2 Background Information

DPP7 (dipeptidylpeptidase 7), also known as DPPII and DPP2, is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. Dipeptidyl peptidases (DPPs) have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. DPPs mediate regulatory activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. DPPs can bind specific voltage-gated potassium channels and alter their expression and biophysical properties and may also influence T cells. DPP proteins include DPRP1, DPRP2, DPP3, DPP7, DPP10, DPPX and CD26. It localizes to lysosomes. DPP7 localizes to lysosomes and exists as a homodimer via its leucine zipper motif and is involved in the degradation of oligopeptides. In response to calcium release, it can be secreted in its active form. It is essential for lymphocyte survival, as the inhibition of DPP7 results in quiescent cell apoptosis.

Full Name
dipeptidyl-peptidase 7
References
  • Chiravuri M, et al. (1999) A novel apoptotic pathway in quiescent lymphocytes identified by inhibition of a post-proline cleaving aminodipeptidase: a candidate target protease, quiescent cell proline dipeptidase. J Immunol. 163(6):3092-9.
  • Fukasawa KM, et al. (2001) Cloning and functional expression of rat kidney dipeptidyl peptidase II. Biochem J. 353(Pt 2):283-90.
  • Fornas E, et al. (1992) Effect of cholesterol and its autooxidation derivatives on endocytosis and dipeptidyl peptidases of aortic endothelial cells. Histol Histopathol. 7(2):163-8.
  • DPP2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    DPP2 cDNA ORF Clone in Cloning Vector, Rat RG86231-U
    DPP2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86231-ACGLN

    DPP2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DPP2 cDNA ORF Clone in Cloning Vector, Mouse MG51019-G
    DPP2 cDNA ORF Clone, Mouse, untagged MG51019-UT
    DPP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51019-ACGLN
    DPP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51019-ACG
    DPP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51019-ACR
    DPP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51019-NF
    DPP2 cDNA ORF Clone, Mouse, C-His tag MG51019-CH
    DPP2 cDNA ORF Clone, Mouse, N-His tag MG51019-NH
    DPP2 cDNA ORF Clone, Mouse, C-HA tag MG51019-CY
    DPP2 cDNA ORF Clone, Mouse, N-HA tag MG51019-NY
    DPP2 cDNA ORF Clone, Mouse, C-Myc tag MG51019-CM
    DPP2 cDNA ORF Clone, Mouse, N-Myc tag MG51019-NM
    DPP2 qPCR Primer Pairs, Mouse MP200978

    DPP2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DPP2 cDNA ORF Clone in Cloning Vector, Human HG10748-M
    DPP2 cDNA ORF Clone, Human, untagged HG10748-UT
    DPP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10748-ACG
    DPP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10748-ACGLN
    DPP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10748-ACR
    DPP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10748-CF
    DPP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10748-NF
    DPP2 cDNA ORF Clone, Human, C-His tag HG10748-CH
    DPP2 cDNA ORF Clone, Human, N-His tag HG10748-NH
    DPP2 cDNA ORF Clone, Human, C-HA tag HG10748-CY
    DPP2 cDNA ORF Clone, Human, N-HA tag HG10748-NY
    DPP2 cDNA ORF Clone, Human, C-Myc tag HG10748-CM
    DPP2 cDNA ORF Clone, Human, N-Myc tag HG10748-NM
    DPP2 qPCR Primer Pairs, Human HP100681
    info info
    添加购物车成功! 添加购物车失败!