CD79A cDNA ORF Clone, Mouse, N-His tag

Cat: MG50734-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CD79A Reagents

CRO Services

Product recommended


All CD79A Reagents

CD79A cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
663 bp
Description
Full length Clone DNA of Mouse CD79A antigen (immunoglobulin-associated alpha) with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD79A cDNA ORF Clone, Mouse, N-His tag Alternative Names

Ig-alpha cDNA ORF Clone, Mouse;Iga cDNA ORF Clone, Mouse;Igalpha cDNA ORF Clone, Mouse;Ly-54 cDNA ORF Clone, Mouse;Ly54 cDNA ORF Clone, Mouse;mb-1 cDNA ORF Clone, Mouse

CD79A Background Information

Full Name
CD79a molecule, immunoglobulin-associated alpha

CD79A cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CD79A cDNA ORF Clone, Rhesus, untagged CG90878-UT
CD79A Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90878-ACGLN

CD79A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD79A cDNA ORF Clone in Cloning Vector, Mouse MG50734-G
CD79A cDNA ORF Clone, Mouse, untagged MG50734-UT
CD79A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50734-ACGLN
CD79A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50734-ACG
CD79A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50734-ACR
CD79A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50734-CF
CD79A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50734-NF
CD79A cDNA ORF Clone, Mouse, C-His tag MG50734-CH
CD79A cDNA ORF Clone, Mouse, C-HA tag MG50734-CY
CD79A cDNA ORF Clone, Mouse, N-HA tag MG50734-NY
CD79A cDNA ORF Clone, Mouse, C-Myc tag MG50734-CM
CD79A cDNA ORF Clone, Mouse, N-Myc tag MG50734-NM
CD79A qPCR Primer Pairs, Mouse MP200709

CD79A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD79A cDNA ORF Clone in Cloning Vector, Human HG13208-G
CD79A cDNA ORF Clone, Human, untagged HG13208-UT
CD79A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13208-ACGLN
CD79A cDNA ORF Clone, Human, C-GFPSpark® tag HG13208-ACG
CD79A cDNA ORF Clone, Human, C-OFPSpark® tag HG13208-ACR
CD79A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13208-CF
CD79A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13208-NF
CD79A cDNA ORF Clone, Human, C-His tag HG13208-CH
CD79A cDNA ORF Clone, Human, N-His tag HG13208-NH
CD79A cDNA ORF Clone, Human, C-HA tag HG13208-CY
CD79A cDNA ORF Clone, Human, N-HA tag HG13208-NY
CD79A cDNA ORF Clone, Human, C-Myc tag HG13208-CM
CD79A cDNA ORF Clone, Human, N-Myc tag HG13208-NM
CD79A qPCR Primer Pairs, Human HP101779
info info
添加购物车成功! 添加购物车失败!