CD36 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6 C>A, 1413 G>T and 1414A>G not causing the amino acid variation.
Description
Full length Clone DNA of Mouse CD36 antigen with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.47kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**
CD36 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
CD36 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
FAT cDNA ORF Clone, Mouse;GPIV cDNA ORF Clone, Mouse;Scarb3 cDNA ORF Clone, Mouse
CD36 Background Information
The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 36 (CD36), also known as FAT, SCARB3, GP88, glycoprotein IV (gpIV) and glycoprotein IIIb (gpIIIb), is a member of the CD system as well as the class B scavenger receptor family of cell surface proteins. CD36 can be found on the surface of many cell types in vertebrate animals and it consists of 472 amino acids and is extensively glycosylated. It is an integral membrane protein primarily serving as receptors for thrombospondin and collagen and by the erythrocytes infected with the human malaria parasite. The role of CD36 as a cell surface receptor has been extended to that of a signal transduction molecule.
Full Name
CD36 molecule (thrombospondin receptor)
References
Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.Greenwalt RH, et al. (1992) Membrane glycoprotein in CD36: a review of its roles in adherence, signal transduction, and transfusion medicine. The journal of the American society of hematology. 80 (5): 1105-15.